Human ACY3 cDNA Clone BC008689 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL842682HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACY3
Gene ID:
91703
Accession #:
BC008689
Plasmid:
pUC
€349.00
Frequently bought together:

Description

Human ACY3 cDNA Clone BC008689 pUC Plasmid | Cusabio

Gene Name: ACY3

Gene ID: 91703

Accession Number: BC008689

Vector: pUC

Sequence: ATGTGCTCACTGCCTGTGCCCCGGGAGCCCCTGCGTCGCGTGGCTGTGACTGGGGGCACGCATGGCAACGAGATGTCGGGCGTCTACCTGGCCCGGCACTGGCTGCATGCCCCCGCAGAGCTGCAGAGAGCCAGCTTCTCCGCTGTGCCTGTGCTGGCCAACCCGGCAGCCACATCCGGCTGCCGCCGCTACGTGGACCATGACCTCAACCGCACCTTCACCAGCAGCTTCCTCAATTCCAGGCCCACCCCGGACGACCCATATGAGGTGACAAGAGCCCGAGAGCTGAACCAGCTGCTGGGGCCCAAGGCCTCGGGCCAGGCCTTTGACTTTGTCCTTGACCTGCACAACACCACGGCCAACATGGGCACCTGCTTAATCGCGAAGTCCTCCCACGAAGTCTTTGCCATGCACCTGTGCCGCCATCTGCAGCTGCAGTACCCCGAGCTGTCCTGCCAGGTCTTCCTGTACCAGCGGTCTGGGGAGGAGAGCTACAACCTGGACTCTGTGGCCAAAAATGGACTGGGTCTGGAGCTGGGCCCCCAGCCACAGGGTGTGCTGCGGGCTGACATTTTCTCAAGGATGAGGACCCTGGTGGCCACAGTTCTGGACTTCATCGAACTCTTCAACCAGGGTACGGCCTTTCCTGCCTTTGAGATGGAAGCCTATAGACCCGTGGGCGTCGTGGACTTCCCCCGCACCGAGGCCGGGCACCTGGCAGGCACTGTGCATCCTCAGCTGCAGGACCGAGACTTCCAGCCACTGCAGCCTGGTGCTCCCATCTTCCAGATGTTCAGTGGGGAGGACCTGCTCTATGAGGGAGAGTCCACGGTGTACCCCGTGTTCATTAACGAGGCTGCCTACTATGAGAAGGGCGTTGCCTTTGTCCAGACTGAGAAGTTCACATTCACCGTGCCTGCCATGCCCGCGCTGACCCCTGCCCCGAGCCCAGCTTCCTAA

Length: 960

View AllClose

0 Reviews

View AllClose