Human ACTR2 cDNA Clone BC014546 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001248HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACTR2
Gene ID:
10097
Accession #:
BC014546
Plasmid:
pUC
€408.00
Frequently bought together:

Description

Human ACTR2 cDNA Clone BC014546 pUC Plasmid | Cusabio

Gene Name: ACTR2

Gene ID: 10097

Accession Number: BC014546

Vector: pUC

Sequence: ATGGACAGCCAGGGCAGGAAGGTGGTGGTGTGCGACAACGGCACCGGGTTTGTGAAGTGTGGATATGCAGGCTCTAACTTTCCAGAACACATCTTCCCAGCTTTGGTTGGAAGACCTATTATCAGATCAACCACCAAAGTGGGAAACATTGAAATCAAGGATCTTATGGTTGGTGATGAGGCAAGTGAATTACGATCAACGTTAGAAGTTAACTACCCTATGGAAAATGGCATAGTACGAAATTGGGATGACATGAAACACCTGTGGGACTACACATTTGGACCAGAGAAACTTAATATAGATACCAGAAATTGTAAAATCTTACTCACAGAACCTCCTATGAACCCAACCAAAAACAGAGAGAAGATTGTAGAGGTAATGTTTGAAACTTACCAGTTTTCCGGTGTATATGTAGCCATCCAGGCAGTTCTGACTTTGTACGCTCAAGGTTTATTGACTGGTGTAGTGGTAGACTCTGGAGATGGTGTGACTCACATTTGCCCAGTATATGAAAGCTTTTCTCTCCCTCATCTTACCAGGAGACTGGATATTGCTGGGAGGGATATAACTAGATATCTTATCAAGCTACTTCTGTTGCGAGGATACGCCTTCAACCACTCTGCTGATTTTGAAACGGTTCGCATGATTAAAGAAAAACTGTGTTACGTGGGATATAATATTGAGCAAGAGCAGAAACTGGCCTTAGAAACCACAGTATTAGTTGAATCTTATACACTCCCAGATGGACGTATCATCAAAGTTGGGGGAGAGAGATTTGAAGCACCAGAAGCTTTATTTCAGCCTCACTTGATCAATGTTGAAGGAGTTGGTGTTGCTGAATTGCTTTTTAACACAATTCAGGCAGCTGACATTGATACCAGATCTGAATTCTACAAACACATTGTGCTTTCTGGAGGGTCTACTATGTATCCTGGCCTGCCATCACGGTTGGAACGAGAACTTAAACAGCTTTACTTAGAACGAGTTTTGAAGGGTGATGTGGAAAAACTTTCTAAATTTAAGATCCGCATTGAAGACCCACCCCGCAGAAAGCACATGGTATTCCTGGGTGGTGCAGTTCTAGCGGATATCATGAAAGACAAAGACAACTTTTGGATGACCCGACAAGAGTACCAAGAAAAAGGTGTCCGTGTGCTAGAGAAACTTGGTGTGACTGTTCGATAA

Length: 1185

View AllClose

0 Reviews

View AllClose