Human ACTN2 cDNA Clone BC051770 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001242HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACTN2
Gene ID:
88
Accession #:
BC051770
Plasmid:
pUC
€798.00
Frequently bought together:

Description

Human ACTN2 cDNA Clone BC051770 pUC Plasmid | Cusabio

Gene Name: ACTN2

Gene ID: 88

Accession Number: BC051770

Vector: pUC

Sequence: ATGAACCAGATAGAGCCCGGCGTGCAGTACAACTACGTGTACGACGAGGATGAGTACATGATCCAGGAGGAGGAGTGGGACCGCGACCTGCTCCTGGACCCAGCCTGGGAGAAGCAGCAGAGGAAGACCTTCACTGCCTGGTGTAACTCCCACCTAAGGAAAGCCGGCACCCAGATTGAGAACATCGAGGAAGACTTCAGGAATGGCCTTAAGCTCATGCTGCTTTTGGAAGTCATCTCAGGGGAAAGGCTGCCCAAACCTGACCGGGGAAAAATGCGGTTCCACAAAATTGCTAATGTCAACAAAGCTTTGGATTACATAGCCAGCAAAGGGGTGAAACTGGTGTCCATCGGCGCTGAAGAAATTGTTGATGGCAATGTGAAAATGACCCTGGGTATGATCTGGACCATCATCCTTCGCTTTGCTATTCAGGATATTTCGGTTGAAGAAACATCTGCCAAAGAAGGTCTGCTGCTTTGGTGTCAGAGGAAAACTGCTCCTTATAGAAATGTGAACATTCAGAACTTCCATACTAGCTGGAAAGATGGCCTTGGACTCTGTGCCCTCATCCACCGACACCGGCCTGACCTCATTGACTACTCAAAGCTTAACAAGGATGACCCCATAGGAAATATTAACCTGGCCATGGAAATCGCTGAGAAGCACCTGGATATTCCTAAAATGTTGGATGCTGAAGACATCGTGAACACCCCTAAACCCGATGAAAGAGCCATCATGACGTACGTCTCTTGCTTCTACCACGCTTTTGCGGGCGCGGAGCAGGCCGAGACAGCGGCTAACAGGATATGTAAGGTTCTTGCTGTGAATCAAGAGAATGAGAGGCTGATGGAAGAATATGAGAGGCTAGCGAGTGAGCTTTTGGAATGGATTCGTCGCACGATCCCCTGGCTGGAGAACCGGACTCCCGAGAAGACCATGCAAGCCATGCAGAAGAAGCTGGAGGACTTCCGGGATTACCGCCGGAAGCACAAGCCACCCAAGGTGCAGGAGAAATGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTGCGGATCAGCAACCGTCCTGCCTTCATGCCCTCCGAGGGCAAGATGGTGTCGGATATTGCTGGTGCCTGGCAGAGGCTGGAGCAGGCTGAGAAGGGTTACGAGGAGTGGTTGCTCAATGAGATTCGGAGACTGGAGCGCTTGGAACACCTGGCTGAGAAGTTCAGGCAGAAGGCCTCAACGCACGAGACTTGGGCTTATGGCAAAGAGCAGATCTTGCTGCAGAAGGATTACGAGTCGGCGTCGCTGACAGAGGTGCGGGCTCTGCTGCGGAAGCACGAGGCGTTCGAGAGCGACCTGGCAGCGCACCAGGACCGCGTGGAGCAGATCGCAGCCATCGCGCAGGAGCTCAATGAACTGGACTATCACGACGCTGTGAATGTCAATGATCGGTGCCAGAAAATTTGTGACCAGTGGGACCGACTGGGAACGCTTACTCAGAAGAGGAGAGAAGCCCTAGAGAGAATGGAGAAATTGCTAGAAACCATTGATCAGCTTCACCTGGAGTTTGCCAAGAGGGCTGCTCCTTTCAACAATTGGATGGAGGGCGCTATGGAGGATCTGCAAGATATGTTCATTGTCCACAGCATTGAGGAGATCCAGAGTCTGATCACTGCGCATGAGCAGTTCAAGGCCACGCTGCCCGAGGCGGACGGAGAGCGGCAGTCCATCATGGCCATCCAGAACGAGGTGGAGAAGGTGATTCAGAGCTACAACATCAGAATCAGCTCAAGCAACCCGTACAGCACTGTCACCATGGATGAGCTCCGGACCAAGTGGGACAAGGTGAAGCAACTCGTGCCCATCCGCGATCAATCCCTGCAGGAGGAGCTGGCTCGCCAGCATGCTAACGAGCGTCTGAGGCGCCAGTTTGCTGCCCAAGCCAATGCCATTGGGCCCTGGATCCAGAACAAGATGGAGGAGATTGCCCGGAGCTCCATCCAGATCACAGGAGCCCTGGAAGACCAGATGAACCAGCTGAAGCAGTATGAGCACAACATCATCAACTATAAGAACAACATCGACAAGCTGGAGGGAGACCATCAGCTCATCCAGGAGGCCCTTGTCTTTGACAACAAGCACACGAACTACACGATGGAGCACATTCGTGTTGGATGGGAGCTGCTGCTGACAACCATCGCCAGAACCATCAATGAGGTGGAGACTCAGATCCTGACGAGAGATGCGAAGGGCATCACCCAGGAGCAGATGAATGAGTTCAGAGCCTCCTTCAACCACTTTGACAGGAGGAAGAATGGCCTGATGGATCATGAGGATTTCAGAGCCTGCCTGATTTCCATGGGTTATGACCTGGGTGAAGCCGAATTTGCCCGCATTATGACCCTGGTAGATCCCAACGGGCAAGGCACCGTCACCTTCCAATCCTTCATCGACTTCATGACTAGAGAGACGGCTGACACCGACACTGCCGAGCAGGTCATCGCCTCCTTCCGGATCCTGGCTTCTGATAAGCCATACATCCTGGCGGAGGAGCTGCGTCGGGAGCTGCCCCCGGATCAGGCCCAGTACTGCATCAAGAGGATGCCCGCCTACTCGGGCCCAGGCAGTGTGCCTGGTGCACTGGATTACGCTGCGTTCTCTTCCGCACTCTACGGGGAGAGCGATCTGTGA

Length: 2685

View AllClose

0 Reviews

View AllClose