Human ACTL6A cDNA Clone BC036371 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001236HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACTL6A
Gene ID:
86
Accession #:
BC036371
Plasmid:
pUC
€435.00
Frequently bought together:

Description

Human ACTL6A cDNA Clone BC036371 pUC Plasmid | Cusabio

Gene Name: ACTL6A

Gene ID: 86

Accession Number: BC036371

Vector: pUC

Sequence: ATGAGCGGCGGCGTGTACGGGGGAGATGAAGTTGGAGCCCTTGTTTTTGACATTGGATCCTATACTGTGAGAGCTGGTTATGCTGGTGAGGACTGCCCCAAGGTGGATTTTCCTACAGCTATTGGTATGGTGGTAGAAAGAGATGACGGAAGCACATTAATGGAAATAGATGGCGATAAAGGCAAACAAGGCGGTCCCACCTACTACATAGATACTAATGCTCTGCGTGTTCCGAGGGAGAATATGGAGGCCATTTCACCTCTAAAAAATGGGATGGTTGAAGACTGGGATAGTTTCCAAGCTATTTTGGATCATACCTACAAAATGCATGTCAAATCAGAAGCCAGTCTCCATCCTGTTCTCATGTCAGAGGCACCGTGGAATACTAGAGCAAAGAGAGAGAAACTGACAGAGTTAATGTTTGAACACTACAACATCCCTGCCTTCTTCCTTTGCAAAACTGCAGTTTTGACAGCATTTGCTAATGGTCGTTCTACTGGGCTGATTTTGGACAGTGGAGCCACTCATACCACTGCAATTCCAGTCCACGATGGCTATGTCCTTCAACAAGGCATTGTGAAATCCCCTCTTGCTGGAGACTTTATTACTATGCAGTGCAGAGAACTCTTCCAAGAAATGAATATTGAATTGGTTCCTCCATATATGATTGCATCAAAAGAAGCTGTTCGTGAAGGATCTCCAGCAAACTGGAAAAGAAAAGAGAAGTTGCCTCAGGTTACGAGGTCTTGGCACAATTATATGTGTAATTGTGTTATCCAGGATTTTCAAGCTTCGGTACTTCAAGTGTCAGATTCAACTTATGATGAACAAGTGGCTGCACAGATGCCAACTGTTCATTATGAATTCCCCAATGGCTACAATTGTGATTTTGGTGCAGAGCGGCTAAAGATTCCAGAAGGATTATTTGACCCTTCCAATGTAAAGGGGTTATCAGGAAACACAATGTTAGGAGTCAGTCATGTTGTCACCACAAGTGTTGGGATGTGTGATATTGACATCAGACCAGGTCTCTATGGCAGTGTAATAGTGGCAGGAGGAAACACACTAATACAGAGTTTTACTGACAGGTTGAATAGAGAGCTGTCTCAGAAAACTCCTCCAAGTATGCGGTTGAAATTGATTGCAAATAATACAACAGTGGAACGGAGGTTTAGCTCATGGATTGGCGGCTCCATTCTAGCCTCTTTGGGTACCTTTCAACAGATGTGGATTTCCAAGCAAGAATATGAAGAAGGAGGGAAGCAGTGTGTAGAAAGAAAATGCCCTTGA

Length: 1290

View AllClose

0 Reviews

View AllClose