Human ACSS3 cDNA Clone BC009317 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL887990HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACSS3
Gene ID:
79611
Accession #:
BC009317
Plasmid:
pUC
€635.00
Frequently bought together:

Description

Human ACSS3 cDNA Clone BC009317 pUC Plasmid | Cusabio

Gene Name: ACSS3

Gene ID: 79611

Accession Number: BC009317

Vector: pUC

Sequence: ATGAAACCGTCTTGGCTGCAGTGTCGTAAAGTCACCAGCGCCGGGGGGCTCGGAGGGCCCTTGCCTGGGTCCTCTCCGGCCCGGGGAGCCGGTGCGGCCCTCAGGGCTTTAGTGGTCCCGGGCCCGCGGGGCGGTCTCGGGGGCCGGGGATGCAGGGCACTGTCCTCCGGCAGTGGCAGCGAGTACAAGACCCACTTCGCAGCCTCGGTGACCGACCCCGAGAGGTTCTGGGGCAAAGCTGCCGAGCAGATCAGCTGGTACAAGCCCTGGACCAAAACGCTGGAGAACAAACACTCGCCCTCTACCAGGTGGTTTGTGGAAGGAATGCTTAACATTTGTTACAATGCCGTTGATCGTCATATTGAAAATGGTAAAGGGGATAAGATTGCTATCATCTATGACAGTCCTGTTACAAACACTAAAGCAACCTTTACCTATAAAGAAGTTCTGGAGCAGGTCTCCAAGCTGGCTGGTGTCTTGGTCAAGCATGGCATCAAGAAAGGTGACACTGTGGTTATCTACATGCCTATGATCCCACAGGCGATGTATACCATGTTGGCATGTGCAAGGATAGGTGCCATCCACAGTCTCATATTTGGAGGATTTGCTTCCAAAGAACTAAGTAGTCGCATTGATCATGTAAAGCCCAAGGTGGTTGTTACAGCATCATTTGGCATTGAACCTGGAAGGAGGGTAGAGTACGTACCACTTGTAGAAGAAGCGCTAAAAATAGGACAACACAAACCAGACAAAATTCTCATTTATAATCGTCCAAATATGGAGGCGGTTCCTTTGGCTCCCGGTCGTGACCTTGATTGGGATGAAGAGATGGCAAAAGCCCAGTCACATGACTGTGTTCCTGTTCTTTCAGAACACCCACTGTATATTCTTTACACATCTGGCACAACGGGGTTACCTAAGGGTGTGATTAGGCCCACTGGGGGATACGCTGTCATGCTACACTGGTCAATGTCTTCCATATACGGACTTCAACCCGGAGAGGTGTGGTGGGCAGCTTCTGACTTAGGCTGGGTTGTTGGACATTCCTATATCTGCTATGGACCTCTTCTTCATGGGAACACAACAGTTTTATATGAGGGGAAGCCTGTGGGAACACCAGATGCTGGCGCTTATTTCCGTGTGCTTGCAGAGCATGGAGTAGCTGCCTTGTTTACAGCACCAACTGCAATTAGAGCAATCCGTCAACAGGACCCTGGGGCAGCTTTGGGGAAGCAGTACTCTCTGACAAGGTTCAAAACATTATTTGTGGCTGGAGAACGATGTGATGTAGAGACCCTGGAATGGTCCAAAAATGTCTTCAGAGTACCTGTCTTAGACCATTGGTGGCAAACTGAGACTGGATCTCCAATTACTGCGTCATGTGTTGGATTAGGCAATTCTAAAACACCTCCACCAGGGCAAGCAGGAAAAAGCGTCCCAGGATACAATGTTATGATTTTGGATGACAACATGCAAAAACTGAAGGCTCGGTGTTTAGGAAATATTGTGGTAAAGTTACCATTGCCACCTGGGGCTTTTTCAGGACTCTGGAAGAATCAGGAAGCATTCAAGCATTTATACTTTGAAAAATTTCCTGGATATTATGATACCATGGATGCTGGTTACATGGATGAAGAAGGCTATTTGTATGTTATGTCTCGAGTGGATGATGTAATAAATGTTGCAGGTCACAGAATTTCTGCAGGCGCCATTGAAGAGTCAATCCTTTCCCATGGTACCGTGGCAGACTGTGCTGTTGTTGGCAAGGAAGATCCCTTAAAAGGTCATGTCCCCTTAGCACTCTGTGTATTGAGAAAAGATATAAATGCAACAGAGGAGCAAGTTTTGGAAGAAATTGTGAAACACGTTAGACAGAACATTGGCCCTGTGGCTGCTTTTCGAAATGCAGTGTTTGTCAAACAGCTACCCAAAACCAGATCTGGCAAGATCCCCCGATCAGCTTTATCTGCCATTGTCAATGGCAAGCCATACAAGATAACTTCTACAATTGAAGACCCCAGCATTTTTGGCCACGTAGAAGAAATGCTGAAGCAAGCATAA

Length: 2061

View AllClose

0 Reviews

View AllClose