Human ACOT8 cDNA Clone BC117155 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001170HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACOT8
Gene ID:
10005
Accession #:
BC117155
Plasmid:
pUC
€349.00
Frequently bought together:

Description

Human ACOT8 cDNA Clone BC117155 pUC Plasmid | Cusabio

Gene Name: ACOT8

Gene ID: 10005

Accession Number: BC117155

Vector: pUC

Sequence: ATGTCGTCCCCGCAGGCCCCAGAAGATGGGCAGGGCTGTGGCGACCGCGGCGATCCCCCTGGGGACCTCCGTAGCGTCTTGGTCACGACCGTGCTCAACCTCGAGCCGCTGGACGAGGATCTCTTCAGAGGAAGGCATTACTGGGTACCGGCCAAGAGGCTGTTTGGTGGTCAGATCGTGGGCCAGGCCCTGGTGGCTGCAGCCAAGTCTGTGAGTGAAGACGTCCACGTGCACTCCCTGCACTGCTACTTTGTTCGGGCAGGGGACCCGAAGCTGCCAGTACTGTACCAAGTGGAGCGGACACGAACAGGGTCGAGCTTCTCGGTGCGCTCTGTGAAGGCCGTGCAACATGGGAAGCCCATCTTCATCTGCCAGGCCTCCTTCCAGCAGGCCCAGCCCAGCCCCATGCAGCACCAGTTCTCCATGCCCACTGTGCCACCACCAGAAGAGCTGCTTGACTGTGAGACCCTCATTGACCAGTATTTAAGGGACCCTAACCTCCAAAAGAGGTACCCATTGGCGCTCAACCGAATTGCTGCTCAGGAGGTCCCCATTGAGATCAAGCCAGTAAACCCATCCCCCCTGAGCCAGCTGCAGAGAATGGAGCCCAAACAGATGTTCTGGGTGCGAGCCCGGGGCTATATTGGCGAGGGCGACATGAAGATGCACTGCTGCGTGGCCGCCTATATCTCCGACTATGCCTTCTTGGGCACTGCACTGCTGCCTCACCAGTGGCAGCACAAGGTGCACTTCATGGTCTCACTGGACCATTCCATGTGGTTCCACGCCCCCTTCCGAGCTGACCACTGGATGCTCTATGAATGCGAGAGCCCCTGGGCCGGTGGCTCTCGGGGGCTGGTCCATGGGCGGCTGTGGCGTCAGGATGGAGTCCTAGCTGTGACCTGTGCCCAGGAGGGCGTGATCCGAGTGAAGCCCCAGGTCTCAGAGAGCAAGCTGTAG

Length: 960

View AllClose

0 Reviews

View AllClose