Human ACLY cDNA Clone BC006195 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001158HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACLY
Gene ID:
47
Accession #:
BC006195
Plasmid:
pUC
€1,123.00
Frequently bought together:

Description

Human ACLY cDNA Clone BC006195 pUC Plasmid | Cusabio

Gene Name: ACLY

Gene ID: 47

Accession Number: BC006195

Vector: pUC

Sequence: ATGTCGGCCAAGGCAATTTCAGAGCAGACGGGCAAAGAACTCCTTTACAAGTTCATCTGTACCACCTCAGCCATCCAGAATCGGTTCAAGTATGCTCGGGTCACTCCTGACACAGACTGGGCCCGCTTGCTGCAGGACCACCCCTGGCTGCTCAGCCAGAACTTGGTAGTCAAGCCAGACCAGCTGATCAAACGTCGTGGAAAACTTGGTCTCGTTGGGGTCAACCTCACTCTGGATGGGGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCCACAGTTGGCAAGGCCACAGGCTTCCTCAAGAACTTTCTGATCGAGCCCTTCGTCCCCCACAGTCAGGCTGAGGAGTTCTATGTCTGCATCTATGCCACCCGAGAAGGGGACTACGTCCTGTTCCACCACGAGGGGGGTGTGGACGTGGGTGATGTGGACGCCAAGGCCCAGAAGCTGCTTGTTGGCGTGGATGAGAAACTGAATCCTGAGGACATCAAAAAACACCTGTTGGTCCACGCCCCTGAAGACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGGCCTCTTCAATTTCTACGAGGACTTGTACTTCACCTACCTCGAGATCAATCCCCTTGTAGTGACCAAAGATGGAGTCTATGTCCTTGACTTGGCGGCCAAGGTGGACGCCACTGCCGACTACATCTGCAAAGTGAAGTGGGGTGACATCGAGTTCCCTCCCCCCTTCGGGCGGGAGGCATATCCAGAGGAAGCCTACATTGCAGACCTCGATGCCAAAAGTGGGGCAAGCCTGAAGCTGACCTTGCTGAACCCCAAAGGGAGGATCTGGACCATGGTGGCCGGGGGTGGCGCCTCTGTCGTGTACAGCGATACCATCTGTGATCTAGGGGGTGTCAACGAGCTGGCAAACTATGGGGAGTACTCAGGCGCCCCCAGCGAGCAGCAGACCTATGACTATGCCAAGACTATCCTCTCCCTCATGACCCGAGAGAAGCACCCAGATGGCAAGATCCTCATCATTGGAGGCAGCATCGCAAACTTCACCAACGTGGCTGCCACGTTCAAGGGCATCGTGAGAGCAATTCGAGATTACCAGGGCCCCCTGAAGGAGCACGAAGTCACAATCTTTGTCCGAAGAGGTGGCCCCAACTATCAGGAGGGCTTACGGGTGATGGGAGAAGTCGGGAAGACCACTGGGATCCCCATCCATGTCTTTGGCACAGAGACTCACATGACGGCCATTGTGGGCATGGCCCTGGGCCACCGGCCCATCCCCAACCAGCCACCCACAGCGGCCCACACTGCAAACTTCCTCCTCAACGCCAGCGGGAGCACATCGACGCCAGCCCCCAGCAGGACAGCATCTTTTTCTGAGTCCAGGGCCGATGAGGTGGCGCCTGCAAAGAAGGCCAAGCCTGCCATGCCACAAGATTCAGTCCCAAGTCCAAGATCCCTGCAAGGAAAGAGCACCACCCTCTTCAGCCGCCACACCAAGGCCATTGTGTGGGGCATGCAGACCCGGGCCGTGCAAGGCATGCTGGACTTTGACTATGTCTGCTCCCGAGACGAGCCCTCAGTGGCTGCCATGGTCTACCCTTTCACTGGGGACCACAAGCAGAAGTTTTACTGGGGGCACAAAGAGATCCTGATCCCTGTCTTCAAGAACATGGCTGATGCCATGAGGAAGCATCCGGAGGTAGATGTGCTCATCAACTTTGCCTCTCTCCGCTCTGCCTATGACAGCACCATGGAGACCATGAACTATGCCCAGATCCGGACCATCGCCATCATAGCTGAAGGCATCCCTGAGGCCCTCACGAGAAAGCTGATCAAGAAGGCGGACCAGAAGGGAGTGACCATCATCGGACCTGCCACTGTTGGAGGCATCAAGCCTGGGTGCTTTAAGATTGGCAACACAGGTGGGATGCTGGACAACATCCTGGCCTCCAAACTGTACCGCCCAGGCAGCGTGGCCTATGTCTCACGTTCCGGAGGCATGTCCAACGAGCTCAACAATATCATCTCTCGGACCACGGATGGCGTCTATGAGGGCGTGGCCATTGGTGGGGACAGGTACCCGGGCTCCACATTCATGGATCATGTGTTACGCTATCAGGACACTCCAGGAGTCAAAATGATTGTGGTTCTTGGAGAGATTGGGGGCACTGAGGAATATAAGATTTGCCGGGGCATCAAGGAGGGCCGCCTCACTAAGCCCATCGTCTGCTGGTGCATCGGGACGTGTGCCACCATGTTCTCCTCTGAGGTCCAGTTTGGCCATGCTGGAGCTTGTGCCAACCAGGCTTCTGAAACTGCAGTAGCCAAGAACCAGGCTTTGAAGGAAGCAGGAGTGTTTGTGCCCCGGAGCTTTGATGAGCTTGGAGAGATCATCCAGTCTGTATACGAAGATCTCGTGGCCAATGGAGTCATTGTACCTGCCCAGGAGGTGCCGCCCCCAACCGTGCCCATGGACTACTCCTGGGCCAGGGAGCTTGGTTTGATCCGCAAACCTGCCTCGTTCATGACCAGCATCTGCGATGAGCGAGGACAGGAGCTCATCTACGCGGGCATGCCCATCACTGAGGTCTTCAAGGAAGAGATGGGCATTGGCGGGGTCCTCGGCCTCCTCTGGTTCCAGAAAAGGTTGCCTAAGTACTCTTGCCAGTTCATTGAGATGTGTCTGATGGTGACAGCTGATCACGGGCCAGCCGTCTCTGGAGCCCACAACACCATCATTTGTGCGCGAGCTGGGAAAGACCTGGTCTCCAGCCTCACCTCGGGGCTGCTCACCATCGGGGATCGGTTTGGGGGTGCCTTGGATGCAGCAGCCAAGATGTTCAGTAAAGCCTTTGACAGTGGCATTATCCCCATGGAGTTTGTGAACAAGATGAAGAAGGAAGGGAAGCTGATCATGGGCATTGGTCACCGAGTGAAGTCGATAAACAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAGGCAGCACTTCCCTGCCACTCCTCTGCTCGATTATGCACTGGAAGTAGAGAAGATTACCACCTCGAAGAAGCCAAATCTTATCCTGAATGTAGATGGTCTCATCGGAGTCGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAGGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGGTTCATTGGACACTATCTTGATCAGAAGAGGCTGAAGCAGGGGCTGTATCGTCATCCGTGGGATGATATTTCATATGTTCTTCCGGAACACATGAGCATGTAA

Length: 3306

View AllClose

0 Reviews

View AllClose