Human ACAA1 cDNA Clone BC000635 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001117HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACAA1
Gene ID:
30
Accession #:
BC000635
Plasmid:
pUC
€431.00
Frequently bought together:

Description

Human ACAA1 cDNA Clone BC000635 pUC Plasmid | Cusabio

Gene Name: ACAA1

Gene ID: 30

Accession Number: BC000635

Vector: pUC

Sequence: ATGCAGAGGCTGCAGGTAGTGCTGGGCCACCTGAGGGGTCCGGCCGATTCCGGCTGGATGCCGCAGGCCGCGCCTTGCCTGAGCGGTGCCCCGCAGGCCTCGGCCGCGGACGTGGTGGTGGTGCACGGGCGGCGCACGGCCATCTGCCGGGCGGGCCGCGGCGGCTTCAAGGACACCACCCCCGACGAGCTTCTCTCGGCAGTCATGACCGCGGTTCTCAAGGACGTGAATCTGAGGCCGGAACAGCTGGGGGACATCTGTGTCGGAAATGTGCTGCAGCCTGGGGCCGGGGCAATCATGGCCCGAATCGCCCAGTTTCTGAGTGACATCCCGGAGACTGTGCCTTTGTCCACTGTCAATAGACAGTGTTCGTCGGGGCTACAGGCAGTGGCCAGCATAGCAGGTGGCATCAGAAATGGGTCTTATGACATTGGCATGGCCTGTGGGGTGGAGTCCATGTCCCTGGCTGACAGAGGGAACCCTGGAAATATTACTTCGCGCTTGATGGAGAAGGAGAAGGCCAGAGATTGCCTGATTCCTATGGGGATAACCTCTGAGAATGTGGCTGAGCGGTTTGGCATTTCACGGGAGAAGCAGGATACCTTTGCCCTGGCTTCCCAGCAGAAGGCAGCAAGAGCCCAGAGCAAGGGCTGTTTCCAAGCTGAGATTGTGCCTGTGACCACCACGGTCCATGATGACAAGGGCACCAAGAGGAGCATCACTGTGACCCAGGATGAGGGTATCCGCCCCAGCACCACCATGGAGGGCCTGGCCAAACTGAAGCCTGCCTTCAAGAAAGATGGTTCTACCACAGCTGGAAACTCTAGCCAGGTGAGTGATGGGGCAGCTGCCATCCTGCTGGCCCGGAGGTCCAAGGCAGAAGAGTTGGGCCTTCCCATCCTTGGGGTCCTGAGGTCTTATGCAGTGGTTGGGGTCCCACCTGACATCATGGGCATTGGACCTGCCTATGCCATCCCAGTAGCTTTGCAAAAAGCAGGGCTGACAGTGAGTGACGTGGACATCTTCGAGATCAATGAGGCCTTTGCAAGCCAGGCTGCCTACTGTGTGGAGAAGCTACGACTCCCCCCTGAGAAGGTGAACCCCCTGGGGGGTGCAGTGGCCTTAGGGCACCCACTGGGCTGCACTGGGGCACGACAGGTCATCACGCTGCTCAATGAGCTGAAGCGCCGTGGGAAGAGGGCATACGGAGTGGTGTCCATGTGCATCGGGACTGGAATGGGAGCCGCTGCCGTCTTTGAATACCCTGGGAACTGA

Length: 1275

View AllClose

0 Reviews

View AllClose