Human ABCC9 cDNA Clone BC033804 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001067HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCC9
Gene ID:
10060
Accession #:
BC033804
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human ABCC9 cDNA Clone BC033804 pENTR223.1 Plasmid | Cusabio

Gene Name: ABCC9

Gene ID: 10060

Accession Number: BC033804

Vector: pENTR223.1

Sequence: ATGAGCCTTTCATTTTGTGGTAACAACATTTCTTCATATAATATCAACGATGGTGTACTACAAAATTCCTGCTTTGTGGATGCCCTCAACCTGGTCCCTCATGTCTTTCTGTTGTTTATCACTTTTCCAATATTGTTTATTGGGTGGGGGAGCCAAAGCTCAAAAGTACAAATTCACCACAACACATGGCTTCATTTTCCGGGACATAACCTGAGATGGATTCTTACATTCGCTCTCCTGTTTGTGCATGTCTGTGAAATAGCAGAAGGCATTGTTTCAGACTCGCGGCGGGAATCAAGGCACCTCCACCTCTTTATGCCAGCCGTGATGGGATTCGTTGCCACTACAACATCGATAGTGTATTATCATAATATCGAAACATCAAATTTTCCTAAATTACTTTTAGGTTTTAGCCATCATGAGAGTAAAAGCTGCTATCAACATTCTTAA

Length: 450

View AllClose

0 Reviews

View AllClose