Human ABCB7 cDNA Clone BC006323 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001053HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCB7
Gene ID:
22
Accession #:
BC006323
Plasmid:
pUC
€687.00
Frequently bought together:

Description

Human ABCB7 cDNA Clone BC006323 pUC Plasmid | Cusabio

Gene Name: ABCB7

Gene ID: 22

Accession Number: BC006323

Vector: pUC

Sequence: ATGGCGCTGCTCGCGATGCATTCTTGGCGCTGGGCGGCCGCGGCGGCTGCTTTCGAAAAGCGCCGGCACTCCGCGATTCTGATCCGGCCTTTAGTCTCTGTTAGCGGCTCAGGTCCGCAGTGGAGGCCACATCAACTCGGCGCCTTGGGAACCGCTCGAGCCTACCAGCAGATTCCAGAGTCATTAAAAAGTATCACATGGCAGAGATTGGGAAAAGGCAATTCAGGACAGTTCTTAGATGCTGCAAAGGCTCTCCAGGTATGGCCACTGATAGAAAAGAGGACATGTTGGCATGGTCATGCAGGAGGAGGACTCCACACAGACCCAAAAGAAGGGTTAAAAGATGTTGATACTCGGAAAATCATAAAAGCAATGCTTTCTTATGTGTGGCCCAAAGACAGGCCAGATCTACGAGCTAGAGTTGCCATTTCGCTGGGATTTTTGGGTGGTGCAAAGGCCATGAATATTGTGGTTCCCTTCATGTTTAAATATGCTGTAGACAGCCTCAACCAGATGTCGGGAAACATGCTGAACCTGAGTGATGCACCAAATACAGTTGCAACCATGGCAACAGCAGTTCTGATTGGCTATGGTGTATCAAGAGCTGGAGCTGCTTTTTTTAACGAAGTTCGAAATGCAGTATTTGGCAAGGTAGCCCAGAATTCAATCCGAAGAATAGCCAAAAATGTCTTTCTCCATCTTCACAACCTGGATCTGGGTTTTCACCTGAGCAGACAGACGGGAGCTTTATCTAAGGCTATTGACAGAGGAACAAGGGGTATCAGTTTTGTCCTGAGTGCTTTGGTATTTAATCTTCTTCCCATCATGTTTGAAGTGATGCTTGTCAGTGGTGTTTTGTATTACAAATGCGGTGCCCAGTTTGCTTTGGTAACCCTTGGAACACTTGGTACATACACAGCATTCACAGTTGCAGTCACACGGTGGAGAACTAGATTTAGAATAGAAATGAACAAAGCAGATAATGATGCAGGTAATGCTGCTATAGACTCACTGCTGAATTATGAAACTGTGAAGTATTTTAATAATGAAAGATATGAAGCACAGAGATATGATGGATTTTTGAAGACGTATGAGACTGCTTCATTGAAAAGTACCTCTACTCTGGCTATGCTGAACTTTGGTCAAAGTGCTATTTTCAGTGTCGGTTTAACAGCTATAATGGTGCTCGCCAGTCAGGGAATTGTGGCAGGTACCCTTACTGTTGGAGATCTAGTAATGGTGAATGGACTGCTTTTTCAGCTTTCATTACCCCTGAACTTTCTGGGAACTGTATATAGAGAGACTAGACAAGCACTCATAGATATGAACACCTTGTTTACTCTACTCAAGGTAGACACCCAAATTAAAGACAAAGTGATGGCATCTCCCCTTCAGATCACACCACAGACAGCTACCGTGGCCTTTGATAATGTGCATTTTGAATACATTGAGGGCCAGAAAGTCCTTAGTGGAATATCCTTTGAAGTCCCTGCAGGAAAGAAAGTGGCCATTGTAGGAGGTAGTGGGTCAGGGAAAAGCACAATAGTGAGGCTATTATTTCGCTTCTATGAGCCTCAAAAGGGTAGCATTTATCTTGCTGGTCAAAATATACAAGATGTGAGCCTGGAAAGCCTTCGGAGGGCAGTGGGAGTGGTACCTCAGGATGCTGTCCTCTTCCATAATACTATTTATTACAACCTCTTATATGGAAACATCAGTGCTTCACCTGAGGAAGTGTATGCAGTGGCAAAATTAGCTGGACTTCATGATGCAATTCTTCGAATGCCACATGGATATGACACCCAAGTAGGGGAACGAGGACTCAAGCTTTCAGGAGGAGAAAAGCAAAGAGTAGCAATTGCAAGAGCCATTTTGAAGGACCCCCCAGTCATACTCTATGATGAAGCTACTTCATCGTTAGATTCGATTACTGAAGAGACTATTCTTGGTGCCATGAAGGATGTGGTCAAACACAGAACTTCTATTTTCATTGCACACAGATTGTCAACAGTGGTTGATGCAGATGAAATCATTGTCTTGGATCAGGGTAAGGTAGCCGAACGTGGTACCCACCATGGTTTGCTTGCTAACCCTCATAGTATCTATTCAGAAATGTGGCATACACAGAGCAGCCGTGTGCAGAACCATGATAACCCCAAATGGGAAGCAAAGAAAGAAAATATATCCAAAGAGGAGGAAAGAAAGAAACTACAAGAAGAAATTGTCAATAGTGTGAAAGGCTGTGGAAACTGTTCGTGCTAA

Length: 2262

View AllClose

0 Reviews

View AllClose