Human ABCA8 cDNA Clone BC047765 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001044HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCA8
Gene ID:
10351
Accession #:
BC047765
Plasmid:
pUC
€308.00
Frequently bought together:

Description

Human ABCA8 cDNA Clone BC047765 pUC Plasmid | Cusabio

Gene Name: ABCA8

Gene ID: 10351

Accession Number: BC047765

Vector: pUC

Sequence: ATGAGGAAGAGAAAGATCAGTGTGTGTCAACAAACTTGGGCCTTATTATGCAAGAACTTTCTTAAAAAATGGAGAATGAAAAGAGAGTCCTTAATGGAATGGCTGAATTCATTGCTCCTACTACTTTGTTTGTATATATATCCTCATAGTCATCAAGTAAATGATTTTTCTTCACTGCTTACCATGGACCTGGGACGGGTAGATACATTTAATGAATCCAGATTTTCTGTTGTATACACACCTGTCACCAACACGACCCAACAGATAATGAATAAAGTAGCCTCTACTCCCTTCCTGGCAGGTAAAGAGGTCTTGGGACTGCCAGATGAGGAAAGTATTAAAGAATTCACAGCAAATTATCCTGAAGAAATAGTAAGAGTCACCTTTACTAATACATACTCATATCATTTGAAGTTCTTGCTAGGACATGGAATGCCAGCAAAGAAGGAGCACAAGGACCATACAGCTCATTGTTATGAAACAAATGAAGATGTTTACTGTGAAGTTTCAGTATTTTGGAAGGAAGGTTTTGTGGCTCTTCAAGCTGCCATTAATGCTGCTATTATAGAAATCACAACAAATCACTCAGTGATGGAGGAGCTGATGTCAGTTACTGGAAAAAATATGAAGATGCATTCCTTCATTGGTCAATCAGGAGTTATAACTGATTTGTACCTTTTTTCCTGCATTATTTCATTTTCCTCATTCATTTACTATGCATCTGTTAATGTCACAAGAGAGAGGAAAAGGATGAAGGCCTTGATGACAATGATGGGTCTTCGGGATTCAGCGTTCTGGTGA

Length: 801

View AllClose

0 Reviews

View AllClose