Human AANAT cDNA Clone BC069434 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL623090HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
AANAT
Gene ID:
15
Accession #:
BC069434
Plasmid:
pUC
€262.00
Frequently bought together:

Description

Human AANAT cDNA Clone BC069434 pUC Plasmid | Cusabio

Gene Name: AANAT

Gene ID: 15

Accession Number: BC069434

Vector: pUC

Sequence: ATGTCCACGCAGAGCACCCACCCCCTGAAACCTGAGGCCCCACGTCTGCCACCTGGGATCCCCGAGTCCCCGAGCTGTCAGCGGCGCCACACACTCCCTGCCAGTGAGTTTCGCTGCCTCACCCCGGAGGACGCTGTCAGCGCCTTTGAGATCGAGCGTGAAGCCTTCATCTCCGTCTTGGGCGTCTGCCCCCTGTACCTGGATGAGATCCGGCACTTCCTGACCCTATGTCCAGAGCTGTCCCTGGGCTGGTTCGAGGAGGGCTGCCTTGTGGCCTTCATCATCGGCTCGCTCTGGGACAAGGAGAGACTCATGCAGGAGTCACTGACGCTGCACAGGTCTGGGGGCCACATAGCCCACCTGCATGTGCTGGCCGTGCACCGCGCCTTCCGGCAGCAGGGCAGGGGCCCCATCCTGCTGTGGCGCTACCTGCACCACCTGGGCAGCCAGCCGGCCGTGCGCCGGGCCGCGCTCATGTGCGAGGACGCGCTGGTACCCTTCTATGAGAGGTTCAGCTTCCACGCCGTGGGCCCCTGCGCCATCACCGTGGGCTCCCTCACCTTCATGGAGCTCCACTGCTCCCTGCGGGGCCACCCCTTCCTGCGCAGGAACAGCGGCTGCTGA

Length: 624

View AllClose

0 Reviews

View AllClose