Human A2LD1 cDNA Clone BC001077 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL883610HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
A2LD1
Gene ID:
87769
Accession #:
BC001077
Plasmid:
pUC
€219.00
Frequently bought together:

Description

Human A2LD1 cDNA Clone BC001077 pUC Plasmid | Cusabio

Gene Name: A2LD1

Gene ID: 87769

Accession Number: BC001077

Vector: pUC

Sequence: ATGGCCCTAGTCTTCGTGTACGGCACCCTGAAGCGGGGTCAGCCCAACCACAGGGTCCTGCGGGACGGCGCCCACGGCTCCGCAGCCTTTCGGGCGCGCGGCCGCACGCTGGAGCCCTACCCGTTGGTGATCGCGGGGGAGCACAACATCCCGTGGCTGCTGCACCTGCCCGGCTCGGGGCGCCTCGTGGAGGGCGAGGTCTACGCGGTAGACGAGCGGATGCTGCGCTTTCTGGATGACTTCGAGAGTTGCCCGGCCCTGTACCAGCGCACGGTGCTGCGGGTACAGCTGCTGGAGGACCGGGCCCCGGGCGCAGAGGAGCCGCCAGCGCCCACCGCGGTGCAGTGCTTCGTGTACAGCAGGGCCACCTTCCCGCCGGAGTGGGCCCAGCTCCCGCACCATGACAGCTACGACTCCGAGGGGCCGCACGGGCTGCGCTACAACCCCCGGGAGAACAGATAA

Length: 462

View AllClose

0 Reviews

View AllClose