null

Human A1CF cDNA Clone BC130519 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001002HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
A1CF
Gene ID:
29974
Accession #:
BC130519
Plasmid:
pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human A1CF cDNA Clone BC130519 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: A1CF

Gene ID: 29974

Accession Number: BC130519

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAATCAAATCACAAATCCGGGGATGGATTGAGCGGCACTCAGAAGGAAGCAGCCCTCCGCGCACTGGTCCAGCGCACAGGATATAGCTTGGTCCAGGAAAATGGACAAAGAAAATATGGTGGCCCTCCACCTGGTTGGGATGCTGCACCCCCTGAAAGGGGCTGTGAAATTTTTATTGGAAAACTTCCCCGAGACCTTTTTGAGGATGAGCTTATACCATTATGTGAAAAAATCGGTAAAATTTATGAAATGAGAATGATGATGGATTTTAATGGCAACAATAGAGGATATGCATTTGTAACATTTTCAAATAAAGTGGAAGCCAAGAATGCAATCAAGCAACTTAATAATTATGAAATTAGAAATGGGCGCCTCTTAGGGGTTTGTGCCAGTGTGGACAACTGCCGATTATTTGTTGGGGGCATCCCAAAAACCAAAAAGAGAGAAGAAATCTTATCGGAGATGAAAAAGGTTACTGAAGGTGTTGTCGATGTCATCGTCTACCCAAGCGCTGCAGATAAAACCAAAAACCGAGGCTTTGCCTTCGTGGAGTATGAGAGTCATCGAGCAGCTGCCATGGCGAGGAGGAAACTGCTACCAGGAAGAATTCAGTTATGGGGACATGGTATTGCAGTAGACTGGGCAGAGCCAGAAGTAGAAGTTGATGAAGATACAATGTCTTCAGTGAAAATCCTATATGTAAGAAATCTTATGCTGTCTACCTCTGAAGAGATGATTGAAAAGGAATTCAACAATATCAAACCAGGTGCTGTGGAGAGGGTGAAGAAAATTCGAGACTATGCTTTTGTGCACTTCAGTAACCGAGAAGATGCAGTTGAGGCTATGAAAGCTTTAAATGGCAAGGTGCTGGATGGTTCCCCCATTGAAGTCACCCTAGCAAAACCAGTGGACAAGGACAGTTATGTTAGGTATACCCGAGGCACAGGTGGAAGGGGCACCATGCTGCAAGGAGAGTATACCTACTCTTTGGGCCAAGTTTATGATCCCACCACAACCTACCTTGGAGCTCCTGTCTTCTATGCCCCCCAGACCTATGCAGCAATTCCCAGTCTTCATTTCCCAGCCACCAAAGGACATCTCAGCAACAGAGCCATTATCCGAGCCCCTTCTGTTAGAGAAATTTACATGAATGTACCTGTAGGGGCTGCGGGAGTGAGAGGACTGGGCGGCCGTGGCTATTTGGCATACACAGGCCTGGGTCGAGGATACCAGGTCAAAGGAGACAAAAGAGAAGACAAACTCTATGACATTTTACCTGGGATGGAGCTCACCCCAATGAATCCTGTCACATTAAAACCCCAAGGAATTAAACTCGCTCCCCAGATATTAGAAGAGATTTGTCAGAAAAATAACTGGGGACAGCCAGTGTACCAGCTGCACTCTGCTATTGGACAAGACCAAAGACAGCTATTCTTGTACAAAATAACTATTCCTGCTCTAGCCAGCCAGAATCCTGCAATCCACCCTTTCACACCTCCAAAGCTGAGTGCCTTTGTGGATGAAGCAAAGACGTATGCAGCCGAATACACCCTGCAGACCCTGGGCATCCCCACTGATGGAGGCGATGGCACCATGGCTACTGCTGCTGCTGCTGCTACTGCTTTCCCAGGATATGCTGTCCCTAATGCAACTGCACCCGTGTCTGCAGCCCAGCTCAAGCAAGCGGTAACCCTTGGACAAGACTTAGCAGCATATACAACCTATGAGGTCTACCCAACTTTTGCAGTGACTGCCCGAGGGGATGGATATGGCACCTTCTGA

Length: 1785

View AllClose

0 Reviews

View AllClose