Cusabio Customized Plasmid
Human TMEM185A cDNA Clone BC022405 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL023772HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM185A
- Gene ID:
- 84548
- Accession #:
- BC022405
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human TMEM185A cDNA Clone BC022405 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: TMEM185A
Gene ID: 84548
Accession Number: BC022405
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTTGATTGCAGTGGGCATCCACTTGCTCTTGTTGATGTTTGAAGTTCTGGTCTGTGACAGAATCGAGAGAGGAAGCCATTTCTGGCTCCTGGTCTTCATGCCGCTGTTCTTTGTTTCCCCGGTGTCTGTTGCAGCTTGCGTTTGGGGCTTTCGACATGACAGGTCACTAGAGTTAGAAATCCTGTGTTCTGTCAACATTCTCCAGTTTATATTCATTGCCTTAAGACTGGACAAGATCATCCACTGGCCCTGGCTTGTATGTAACTTTTAA
Length: 273
Related Products
Human TMEM185A cDNA Clone BC103821 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM185A cDNA Clone BC103821 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM185AGene ID: 84548Accession Number: BC103821Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023772HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM185A
- Gene ID:
- 84548
- Accession #:
- BC103821
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM185A cDNA Clone BC013793 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM185A cDNA Clone BC013793 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM185AGene ID: 84548Accession Number: BC013793Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023772HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM185A
- Gene ID:
- 84548
- Accession #:
- BC013793
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid | CusabioGene Name: ABCA11PGene ID: 79963Accession Number: BC098116Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL706339HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ABCA11P
- Gene ID:
- 79963
- Accession #:
- BC098116
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ABI2 cDNA Clone BC001439 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ABI2 cDNA Clone BC001439 pENTR223.1 or pUC Plasmid | CusabioGene Name: ABI2Gene ID: 10152Accession Number: BC001439Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL001102HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ABI2
- Gene ID:
- 10152
- Accession #:
- BC001439
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ACOT11 cDNA Clone BC001517 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ACOT11 cDNA Clone BC001517 pENTR223.1 or pUC Plasmid | CusabioGene Name: ACOT11Gene ID: 26027Accession Number: BC001517Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL855502HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ACOT11
- Gene ID:
- 26027
- Accession #:
- BC001517
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC