Cusabio Customized Plasmid
Human PCGF5 cDNA Clone BC007377 pENTR223.1 or pUC Plasmid
- SKU:
- CSB-CL801218HU1
- UPC:
- MPN:
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- PCGF5
- Gene ID:
- 84333
- Accession #:
- BC007377
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
MSRP:
Now:
€214.00
Was:
— You save
Description
Human PCGF5 cDNA Clone BC007377 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: PCGF5
Gene ID: 84333
Accession Number: BC007377
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGCTACCCAAAGGAAACACTTGGTGAAAGATTTTAATCCTTACATTACCTGCTATATCTGTAAAGGGTATCTGATCAAGCCAACAACAGTGACGGAATGCCTCCATACATCTGCAGAATCCTACTGGATGTCCACTTGGATGTCCTGA
Length: 150
Related Products
![Human PCGF5 cDNA Clone BC051845 pENTR223.1 or pUC Plasmid Human PCGF5 cDNA Clone BC051845 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/20110/28079/cusabio__81676.1638370075__95659.1639270113.jpg?c=1)
Human PCGF5 cDNA Clone BC051845 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human PCGF5 cDNA Clone BC051845 pENTR223.1 or pUC Plasmid | CusabioGene Name: PCGF5Gene ID: 84333Accession Number: BC051845Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL801218HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- PCGF5
- Gene ID:
- 84333
- Accession #:
- BC051845
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/18456/26425/cusabio__81676.1638370075__23218.1639269450.jpg?c=1)
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC41Gene ID: 10489Accession Number: BC004953Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL614889HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC41
- Gene ID:
- 10489
- Accession #:
- BC004953
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/18381/26350/cusabio__81676.1638370075__61659.1639269421.jpg?c=1)
Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid | CusabioGene Name: LMO3Gene ID: 55885Accession Number: BC026311Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL844705HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LMO3
- Gene ID:
- 55885
- Accession #:
- BC026311
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/18478/26447/cusabio__81676.1638370075__72789.1639269459.jpg?c=1)
Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRIQ1Gene ID: 84125Accession Number: BC005399Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL842693HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRIQ1
- Gene ID:
- 84125
- Accession #:
- BC005399
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human LRRC48 cDNA Clone BC050419 pENTR223.1 or pUC Plasmid Human LRRC48 cDNA Clone BC050419 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/18461/26430/cusabio__81676.1638370075__98503.1639269452.jpg?c=1)
Human LRRC48 cDNA Clone BC050419 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human LRRC48 cDNA Clone BC050419 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC48Gene ID: 83450Accession Number: BC050419Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL887941HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC48
- Gene ID:
- 83450
- Accession #:
- BC050419
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human LRRC40 cDNA Clone BC008586 pENTR223.1 or pUC Plasmid Human LRRC40 cDNA Clone BC008586 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/18455/26424/cusabio__81676.1638370075__03840.1639269450.jpg?c=1)
Human LRRC40 cDNA Clone BC008586 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human LRRC40 cDNA Clone BC008586 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC40Gene ID: 55631Accession Number: BC008586Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL881002HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC40
- Gene ID:
- 55631
- Accession #:
- BC008586
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human LYPD4 cDNA Clone BC034629 pENTR223.1 or pUC Plasmid Human LYPD4 cDNA Clone BC034629 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/18547/26516/cusabio__81676.1638370075__19684.1639269487.jpg?c=1)
Human LYPD4 cDNA Clone BC034629 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human LYPD4 cDNA Clone BC034629 pENTR223.1 or pUC Plasmid | CusabioGene Name: LYPD4Gene ID: 147719Accession Number: BC034629Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL751011HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LYPD4
- Gene ID:
- 147719
- Accession #:
- BC034629
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human LY9 cDNA Clone BC064485 pENTR223.1 or pUC Plasmid Human LY9 cDNA Clone BC064485 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/18536/26505/cusabio__81676.1638370075__16116.1639269482.jpg?c=1)
Human LY9 cDNA Clone BC064485 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human LY9 cDNA Clone BC064485 pENTR223.1 or pUC Plasmid | CusabioGene Name: LY9Gene ID: 4063Accession Number: BC064485Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL884511HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LY9
- Gene ID:
- 4063
- Accession #:
- BC064485
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human LYPD6B cDNA Clone BC018203 pENTR223.1 or pUC Plasmid Human LYPD6B cDNA Clone BC018203 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/18549/26518/cusabio__81676.1638370075__32341.1639269488.jpg?c=1)
Human LYPD6B cDNA Clone BC018203 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human LYPD6B cDNA Clone BC018203 pENTR223.1 or pUC Plasmid | CusabioGene Name: LYPD6BGene ID: 130576Accession Number: BC018203Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL822823HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LYPD6B
- Gene ID:
- 130576
- Accession #:
- BC018203
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC