Cusabio Customized Plasmid
Human KRTAP3-3 cDNA Clone BC069448 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL874846HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-3
- Gene ID:
- 85293
- Accession #:
- BC069448
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP3-3 cDNA Clone BC069448 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP3-3
Gene ID: 85293
Accession Number: BC069448
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGATTGCTGTGCCTCTCGAGGCTGCAGTGTCCCCACCGGGCCTGCCACCACCATCTGCTCCTCCGACAAATCCTGTCGCTGTGGAGTCTGCCTGCCCAGCACCTGCCCACACACAGTTTGGTTACTGGAGCCCACCTGCTGTGACAACTGTCCCCCACCCTGCCACATTCCTCAGCCCTGTGTGCCCACCTGCTTCCTGCTCAACTCCTGCCAGCCAACTCCAGGCCTGGAGACCCTCAACCTCACCACCTTCACTCAGCCCTGCTGTGAGCCCTGCCTCCCAAGAGGCTGCTAA
Length: 297
Related Products
Human KRTAP3-1 cDNA Clone BC113077 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP3-1 cDNA Clone BC113077 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP3-1Gene ID: 83896Accession Number: BC113077Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL863160HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-1
- Gene ID:
- 83896
- Accession #:
- BC113077
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP3-2 cDNA Clone BC034582 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP3-2 cDNA Clone BC034582 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP3-2Gene ID: 83897Accession Number: BC034582Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL871617HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-2
- Gene ID:
- 83897
- Accession #:
- BC034582
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP10-3 cDNA Clone BC133677 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP10-3 cDNA Clone BC133677 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP10-3Gene ID: 386682Accession Number: BC133677Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL012597HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP10-3
- Gene ID:
- 386682
- Accession #:
- BC133677
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP13-3 cDNA Clone BC103965 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP13-3 cDNA Clone BC103965 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP13-3Gene ID: 337960Accession Number: BC103965Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL666167HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP13-3
- Gene ID:
- 337960
- Accession #:
- BC103965
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€347.00
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid | CusabioGene Name: FZD2Gene ID: 2535Accession Number: BC113402Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL622766HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FZD2
- Gene ID:
- 2535
- Accession #:
- BC113402
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC