Cusabio Customized Plasmid
Human KRTAP3-2 cDNA Clone BC034582 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL871617HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-2
- Gene ID:
- 83897
- Accession #:
- BC034582
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP3-2 cDNA Clone BC034582 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP3-2
Gene ID: 83897
Accession Number: BC034582
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGATTGCTGTGCCTCTCGCAGCTGCAGTGTCCCCACTGGGCCTGCCACCACCATCTGCTCCTCCGACAAATCCTGCCGCTGTGGAGTCTGCCTGCCCAGCACCTGCCCACACACAGTTTGGTTACTGGAGCCCATCTGCTGTGACAACTGTCCCCCACCCTGCCACATTCCTCAGCCCTGCGTGCCCACCTGCTTCCTGCTCAACTCCTGCCAGCCAACTCCGGGCCTGGAGACCCTCAACCTCACCACCTTCACTCAGCCCTGCTGTGAGCCCTGCCTCCCAAGAGGCTGCTGA
Length: 297
Related Products
Human KRTAP3-1 cDNA Clone BC113077 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP3-1 cDNA Clone BC113077 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP3-1Gene ID: 83896Accession Number: BC113077Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL863160HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-1
- Gene ID:
- 83896
- Accession #:
- BC113077
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP3-3 cDNA Clone BC069448 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP3-3 cDNA Clone BC069448 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP3-3Gene ID: 85293Accession Number: BC069448Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL874846HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-3
- Gene ID:
- 85293
- Accession #:
- BC069448
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP4-2 cDNA Clone BC127252 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP4-2 cDNA Clone BC127252 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP4-2Gene ID: 85291Accession Number: BC127252Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL861178HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-2
- Gene ID:
- 85291
- Accession #:
- BC127252
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP12-2 cDNA Clone BC120941 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP12-2 cDNA Clone BC120941 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP12-2Gene ID: 353323Accession Number: BC120941Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL012606HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-2
- Gene ID:
- 353323
- Accession #:
- BC120941
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€347.00
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC41Gene ID: 10489Accession Number: BC004953Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL614889HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC41
- Gene ID:
- 10489
- Accession #:
- BC004953
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC