Cusabio Customized Plasmid
Human KRTAP3-1 cDNA Clone BC113077 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL863160HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-1
- Gene ID:
- 83896
- Accession #:
- BC113077
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP3-1 cDNA Clone BC113077 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP3-1
Gene ID: 83896
Accession Number: BC113077
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTATTGCTGTGCTCTCCGCTCCTGCAGCGTCCCCACCGGCCCTGCCACCACCTTCTGCTCATTTGATAAAAGCTGCCGCTGTGGAGTCTGCCTACCCAGCACCTGCCCACATGAGATCAGCCTCCTTCAGCCCATCTGCTGTGACACCTGCCCCCCACCCTGCTGCAAGCCTGATACCTATGTGCCAACTTGCTGGCTGCTCAACAACTGTCACCCGACTCCCGGACTGAGTGGGATCAACCTGACCACCTATGTTCAGCCTGGCTGTGAGAGTCCCTGTGAGCCCCGCTGTTAA
Length: 297
Related Products
Human KRTAP3-2 cDNA Clone BC034582 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP3-2 cDNA Clone BC034582 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP3-2Gene ID: 83897Accession Number: BC034582Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL871617HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-2
- Gene ID:
- 83897
- Accession #:
- BC034582
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP3-3 cDNA Clone BC069448 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP3-3 cDNA Clone BC069448 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP3-3Gene ID: 85293Accession Number: BC069448Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL874846HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-3
- Gene ID:
- 85293
- Accession #:
- BC069448
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP8-1Gene ID: 337879Accession Number: BC130397Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814201HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP8-1
- Gene ID:
- 337879
- Accession #:
- BC130397
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP11-1 cDNA Clone BC130555 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP11-1 cDNA Clone BC130555 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP11-1Gene ID: 337880Accession Number: BC130555Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL810266HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP11-1
- Gene ID:
- 337880
- Accession #:
- BC130555
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-1Gene ID: 337882Accession Number: BC126284Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814200HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-1
- Gene ID:
- 337882
- Accession #:
- BC126284
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC