Cusabio Customized Plasmid
Human KRTAP23-1 cDNA Clone BC128435 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL012641HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP23-1
- Gene ID:
- 337963
- Accession #:
- BC128435
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP23-1 cDNA Clone BC128435 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP23-1
Gene ID: 337963
Accession Number: BC128435
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTCCTACAACTGCTGCTGTGGAAACTTCTCCTCCCATTCCTGTGAGGGCTACCTGTGCTACTCAGGCTACTCCCGTGGTGGCTCCTCGTACCCCAGCAACCTGGTCTACAGCACTGAACCTTTGATCTCCCAGCACCTGCCAGCTGGGTTCCTCTCTCTGCAAGGGCTTTCAGGAGACTTGCTGGGAAACCCCTAG
Length: 198
Related Products
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP19-1 cDNA Clone BC126284 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-1Gene ID: 337882Accession Number: BC126284Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814200HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-1
- Gene ID:
- 337882
- Accession #:
- BC126284
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP13-1 cDNA Clone BC113536 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP13-1 cDNA Clone BC113536 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP13-1Gene ID: 140258Accession Number: BC113536Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL815543HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP13-1
- Gene ID:
- 140258
- Accession #:
- BC113536
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP26-1 cDNA Clone BC057825 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP26-1 cDNA Clone BC057825 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP26-1Gene ID: 388818Accession Number: BC057825Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL764791HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP26-1
- Gene ID:
- 388818
- Accession #:
- BC057825
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP8-1 cDNA Clone BC130397 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP8-1Gene ID: 337879Accession Number: BC130397Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL814201HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP8-1
- Gene ID:
- 337879
- Accession #:
- BC130397
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP11-1 cDNA Clone BC130555 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP11-1 cDNA Clone BC130555 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP11-1Gene ID: 337880Accession Number: BC130555Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL810266HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP11-1
- Gene ID:
- 337880
- Accession #:
- BC130555
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP3-1 cDNA Clone BC113077 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP3-1 cDNA Clone BC113077 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP3-1Gene ID: 83896Accession Number: BC113077Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL863160HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP3-1
- Gene ID:
- 83896
- Accession #:
- BC113077
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP4-1 cDNA Clone BC103846 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP4-1 cDNA Clone BC103846 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP4-1Gene ID: 85285Accession Number: BC103846Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL874845HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP4-1
- Gene ID:
- 85285
- Accession #:
- BC103846
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP12-1 cDNA Clone BC127648 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP12-1 cDNA Clone BC127648 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP12-1Gene ID: 353332Accession Number: BC127648Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL012605HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-1
- Gene ID:
- 353332
- Accession #:
- BC127648
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid | CusabioGene Name: ABCA11PGene ID: 79963Accession Number: BC098116Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL706339HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ABCA11P
- Gene ID:
- 79963
- Accession #:
- BC098116
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC