Cusabio Customized Plasmid
Human KRTAP12-4 cDNA Clone BC125198 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL012608HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-4
- Gene ID:
- 386684
- Accession #:
- BC125198
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human KRTAP12-4 cDNA Clone BC125198 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: KRTAP12-4
Gene ID: 386684
Accession Number: BC125198
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTGCCACACCAGCCACTCTTCGGGCTGCCCAATGGCCTGCCCTGGCTCCCCGTGCTGTGTCCCCAGCACCTGCTACCCACCCGAGGGCTATGGGACCTCCTGCTGCTGCTCAGCCCCCTGTGTGGCTCTGCTGTGCCGGCCCCTGTGTGGGGTATCCACCTGCTGCCAGCCAGCCTGCTGTGTGCCCAGCCCCTGCCAGGTGGCCTGCTGTGTGCCTGTGAGCTGCAAGCCTGTTTTGTGTGTGGCTTCCTTCTGCCCAACCTCTGGGTGCTGCCAGCCCTTCTGCCCCACCCTGGTCTATAGACCTGTCACCTGGAGCACCCCCACCGGCTGCTGA
Length: 339
Related Products
Human KRTAP12-2 cDNA Clone BC120941 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP12-2 cDNA Clone BC120941 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP12-2Gene ID: 353323Accession Number: BC120941Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL012606HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-2
- Gene ID:
- 353323
- Accession #:
- BC120941
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP12-1 cDNA Clone BC127648 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP12-1 cDNA Clone BC127648 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP12-1Gene ID: 353332Accession Number: BC127648Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL012605HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP12-1
- Gene ID:
- 353332
- Accession #:
- BC127648
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP2-4 cDNA Clone BC101147 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP2-4 cDNA Clone BC101147 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP2-4Gene ID: 85294Accession Number: BC101147Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL887166HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP2-4
- Gene ID:
- 85294
- Accession #:
- BC101147
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP19-4 cDNA Clone BC117199 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP19-4 cDNA Clone BC117199 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP19-4Gene ID: 337971Accession Number: BC117199Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL660772HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP19-4
- Gene ID:
- 337971
- Accession #:
- BC117199
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human KRTAP13-4 cDNA Clone BC131691 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human KRTAP13-4 cDNA Clone BC131691 pENTR223.1 or pUC Plasmid | CusabioGene Name: KRTAP13-4Gene ID: 284827Accession Number: BC131691Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL667309HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- KRTAP13-4
- Gene ID:
- 284827
- Accession #:
- BC131691
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC