Cusabio Customized Plasmid
Human HLA-DOB cDNA Clone BC020226 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL318411HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-DOB
- Gene ID:
- 3112
- Accession #:
- BC020226
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human HLA-DOB cDNA Clone BC020226 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: HLA-DOB
Gene ID: 3112
Accession Number: BC020226
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGGTTCTGGGTGGGTCCCCTGGGTGGTGGCTCTGCTAGTGAATCTGACCCGACTGGATTCCTCCATGACTCAAGGCACAGACTCTCCAGGTAAGAACAGAGCAATTGTTTTTTTCCAGTGTGTATGCAAGAATTGGCATGGGGGAGTGATGCCTTTCTTTGTAAGTCCAGGCCACAGACCAGACTGGAAGTGGCTTTTGGTTTCAAAGAACAGTGTTCTTCCCTTTGGCAGAAAGGTACGCCTTGCCTCTTTACATGGGATGGACTTCATATACCAGAGCCACCTATTCAAGGGGTAG
Length: 300
Related Products
Human HLA-DOB cDNA Clone BC006097 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-DOB cDNA Clone BC006097 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-DOBGene ID: 3112Accession Number: BC006097Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL318411HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-DOB
- Gene ID:
- 3112
- Accession #:
- BC006097
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human HLA-A cDNA Clone BC008611 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-A cDNA Clone BC008611 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-AGene ID: 3105Accession Number: BC008611Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL318036HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-A
- Gene ID:
- 3105
- Accession #:
- BC008611
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human HLA-DQB2 cDNA Clone BC031995 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-DQB2 cDNA Clone BC031995 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-DQB2Gene ID: 3120Accession Number: BC031995Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL356544HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-DQB2
- Gene ID:
- 3120
- Accession #:
- BC031995
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human HLA-DQA1 cDNA Clone BC125044 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-DQA1 cDNA Clone BC125044 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-DQA1Gene ID: 3117Accession Number: BC125044Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL365686HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-DQA1
- Gene ID:
- 3117
- Accession #:
- BC125044
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human HLA-DQA1 cDNA Clone BC008585 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-DQA1 cDNA Clone BC008585 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-DQA1Gene ID: 3117Accession Number: BC008585Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL365686HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-DQA1
- Gene ID:
- 3117
- Accession #:
- BC008585
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human HLA-DRB3 cDNA Clone BC008987 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-DRB3 cDNA Clone BC008987 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-DRB3Gene ID: 3125Accession Number: BC008987Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL302920HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-DRB3
- Gene ID:
- 3125
- Accession #:
- BC008987
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human HLA-E cDNA Clone BC002578 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-E cDNA Clone BC002578 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-EGene ID: 3133Accession Number: BC002578Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL320269HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-E
- Gene ID:
- 3133
- Accession #:
- BC002578
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human HLA-DRA cDNA Clone BC032350 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-DRA cDNA Clone BC032350 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-DRAGene ID: 3122Accession Number: BC032350Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL360793HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-DRA
- Gene ID:
- 3122
- Accession #:
- BC032350
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human HLA-DRB1 cDNA Clone BC108922 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human HLA-DRB1 cDNA Clone BC108922 pENTR223.1 or pUC Plasmid | CusabioGene Name: HLA-DRB1Gene ID: 3123Accession Number: BC108922Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL319586HU5
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- HLA-DRB1
- Gene ID:
- 3123
- Accession #:
- BC108922
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC