Cusabio Customized Plasmid
Human GNG7 cDNA Clone BC014466 pENTR223.1 or pUC Plasmid
- SKU:
- CSB-CL009619HU
- UPC:
- MPN:
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GNG7
- Gene ID:
- 2788
- Accession #:
- BC014466
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
MSRP:
Now:
€214.00
Was:
— You save
Description
Human GNG7 cDNA Clone BC014466 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: GNG7
Gene ID: 2788
Accession Number: BC014466
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTCAGCCACTAACAACATAGCCCAGGCCCGGAAGCTGGTGGAACAGCTACGCATAGAAGCCGGGATTGAGCGCATCAAGGTCTCCAAAGCGGCGTCTGACCTCATGAGCTACTGTGAGCAACATGCCCGGAACGACCCCCTGCTGGTCGGAGTCCCTGCCTCGGAGAACCCCTTTAAGGACAAGAAACCTTGTATTATTTTATAA
Length: 207
Related Products
![Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16396/24365/cusabio__81676.1638370075__82574.1639268606.jpg?c=1)
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid | CusabioGene Name: FZD2Gene ID: 2535Accession Number: BC113402Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL622766HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FZD2
- Gene ID:
- 2535
- Accession #:
- BC113402
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16405/24374/cusabio__81676.1638370075__25273.1639268609.jpg?c=1)
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid | CusabioGene Name: G6PCGene ID: 2538Accession Number: BC130478Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009118HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC
- Gene ID:
- 2538
- Accession #:
- BC130478
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16371/24340/cusabio__81676.1638370075__87541.1639268597.jpg?c=1)
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid | CusabioGene Name: FUNDC2Gene ID: 65991Accession Number: BC000255Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL861153HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FUNDC2
- Gene ID:
- 65991
- Accession #:
- BC000255
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16406/24375/cusabio__81676.1638370075__04950.1639268610.jpg?c=1)
Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid | CusabioGene Name: G6PC2Gene ID: 57818Accession Number: BC113376Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL873624HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC2
- Gene ID:
- 57818
- Accession #:
- BC113376
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human FYCO1 cDNA Clone BC007218 pENTR223.1 or pUC Plasmid Human FYCO1 cDNA Clone BC007218 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16392/24361/cusabio__81676.1638370075__97813.1639268605.jpg?c=1)
Human FYCO1 cDNA Clone BC007218 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human FYCO1 cDNA Clone BC007218 pENTR223.1 or pUC Plasmid | CusabioGene Name: FYCO1Gene ID: 79443Accession Number: BC007218Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL866262HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FYCO1
- Gene ID:
- 79443
- Accession #:
- BC007218
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human GABPB2 cDNA Clone BC027033 pENTR223.1 or pUC Plasmid Human GABPB2 cDNA Clone BC027033 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16415/24384/cusabio__81676.1638370075__53634.1639268613.jpg?c=1)
Human GABPB2 cDNA Clone BC027033 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human GABPB2 cDNA Clone BC027033 pENTR223.1 or pUC Plasmid | CusabioGene Name: GABPB2Gene ID: 126626Accession Number: BC027033Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL844704HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GABPB2
- Gene ID:
- 126626
- Accession #:
- BC027033
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human GCET2 cDNA Clone BC030506 pENTR223.1 or pUC Plasmid Human GCET2 cDNA Clone BC030506 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16512/24481/cusabio__81676.1638370075__36337.1639268656.jpg?c=1)
Human GCET2 cDNA Clone BC030506 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human GCET2 cDNA Clone BC030506 pENTR223.1 or pUC Plasmid | CusabioGene Name: GCET2Gene ID: 257144Accession Number: BC030506Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL854052HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GCET2
- Gene ID:
- 257144
- Accession #:
- BC030506
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human GEMIN8 cDNA Clone BC003607 pENTR223.1 or pUC Plasmid Human GEMIN8 cDNA Clone BC003607 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16547/24516/cusabio__81676.1638370075__78125.1639268670.jpg?c=1)
Human GEMIN8 cDNA Clone BC003607 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human GEMIN8 cDNA Clone BC003607 pENTR223.1 or pUC Plasmid | CusabioGene Name: GEMIN8Gene ID: 54960Accession Number: BC003607Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL873675HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GEMIN8
- Gene ID:
- 54960
- Accession #:
- BC003607
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human GAGE5 cDNA Clone BC024914 pENTR223.1 or pUC Plasmid Human GAGE5 cDNA Clone BC024914 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/16441/24410/cusabio__81676.1638370075__20655.1639268624.jpg?c=1)
Human GAGE5 cDNA Clone BC024914 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human GAGE5 cDNA Clone BC024914 pENTR223.1 or pUC Plasmid | CusabioGene Name: GAGE5Gene ID: 2577Accession Number: BC024914Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009186HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GAGE5
- Gene ID:
- 2577
- Accession #:
- BC024914
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC