Cusabio Customized Plasmid
Human GATA3 cDNA Clone BC006839 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL009276HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GATA3
- Gene ID:
- 2625
- Accession #:
- BC006839
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human GATA3 cDNA Clone BC006839 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: GATA3
Gene ID: 2625
Accession Number: BC006839
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGAAGGATGCCAAGAAGTTTAAGGAATATGGGAGAAATAGTGTGGAAATTAAGAAGAAACTAGGTCTGATATTCAAATGGACAAACTGCCAGTTTTGTTTCCTTTCACTGGCCACAGTTGTTTGA
Length: 126
Related Products
Human GATA3 cDNA Clone BC003070 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human GATA3 cDNA Clone BC003070 pENTR223.1 or pUC Plasmid | CusabioGene Name: GATA3Gene ID: 2625Accession Number: BC003070Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009276HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GATA3
- Gene ID:
- 2625
- Accession #:
- BC003070
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human GATA3 cDNA Clone BC006793 pUC Plasmid
Cusabio pUC Plasmid
€447.00
Human GATA3 cDNA Clone BC006793 pUC Plasmid | CusabioGene Name: GATA3Gene ID: 2625Accession Number: BC006793Vector: pUCSequence:...
- SKU:
- CSB-CL009276HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GATA3
- Gene ID:
- 2625
- Accession #:
- BC006793
- Plasmid:
- pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€438.00
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC