Cusabio Customized Plasmid
Human CRP cDNA Clone BC070257 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL005991HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- CRP
- Gene ID:
- 1401
- Accession #:
- BC070257
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human CRP cDNA Clone BC070257 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: CRP
Gene ID: 1401
Accession Number: BC070257
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTGGGACTTTGTGCTGTCACCAGATGAGATTAACACCATCTATCTTGGCGGGCCCTTCAGTCCTAATGTCCTGAACTGGCGGGCACTGAAGTATGAAGTGCAAGGCGAAGTGTTCACCAAACCCCAGCTGTGGCCCTGA
Length: 141
Related Products
Human CRP cDNA Clone BC020766 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human CRP cDNA Clone BC020766 pENTR223.1 or pUC Plasmid | CusabioGene Name: CRPGene ID: 1401Accession Number: BC020766Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL005991HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- CRP
- Gene ID:
- 1401
- Accession #:
- BC020766
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human CRP cDNA Clone BC125135 pENTR223.1 Plasmid
Cusabio pENTR223.1 Plasmid
€214.00
Human CRP cDNA Clone BC125135 pENTR223.1 Plasmid | CusabioGene Name: CRPGene ID: 1401Accession Number: BC125135Vector: pENTR223.1Sequence:...
- SKU:
- CSB-CL005991HU3
- Availability:
- 3 to 5 Working Days
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- CRP
- Gene ID:
- 1401
- Accession #:
- BC125135
- Plasmid:
- pENTR223.1
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€438.00
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC