Cusabio Customized Plasmid
Human CDC42SE1 cDNA Clone BC012796 pENTR223.1 or pUC Plasmid
- SKU:
- CSB-CL868304HU
- UPC:
- MPN:
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- CDC42SE1
- Gene ID:
- 56882
- Accession #:
- BC012796
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
MSRP:
Now:
€214.00
Was:
— You save
Description
Human CDC42SE1 cDNA Clone BC012796 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: CDC42SE1
Gene ID: 56882
Accession Number: BC012796
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGAGTGAATTTTGGCACAAACTGGGCTGCTGTGTGGTAGAGAAACCCCAGCCGAAGAAGAAGAGAAGACGGATTGACCGGACCATGATTGGGGAACCAATGAATTTTGTTCACCTGACTCACATTGGCTCAGGGGAGATGGGGGCCGGAGATGGACTTGCCATGACAGGTGCAGTTCAGGAGCAGATGAGATCCAAGGGAAACCGAGATAGGCCATGGAGCAATTCTAGGGGCTTATAG
Length: 240
Related Products
![Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/11976/19945/cusabio__81676.1638370075__19875.1639266844.jpg?c=1)
Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid | CusabioGene Name: ABCA11PGene ID: 79963Accession Number: BC098116Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL706339HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ABCA11P
- Gene ID:
- 79963
- Accession #:
- BC098116
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human ABI2 cDNA Clone BC001439 pENTR223.1 or pUC Plasmid Human ABI2 cDNA Clone BC001439 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/12011/19980/cusabio__81676.1638370075__09966.1639266848.jpg?c=1)
Human ABI2 cDNA Clone BC001439 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human ABI2 cDNA Clone BC001439 pENTR223.1 or pUC Plasmid | CusabioGene Name: ABI2Gene ID: 10152Accession Number: BC001439Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL001102HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ABI2
- Gene ID:
- 10152
- Accession #:
- BC001439
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human ACOT11 cDNA Clone BC001517 pENTR223.1 or pUC Plasmid Human ACOT11 cDNA Clone BC001517 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/12051/20020/cusabio__81676.1638370075__16925.1639266852.jpg?c=1)
Human ACOT11 cDNA Clone BC001517 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human ACOT11 cDNA Clone BC001517 pENTR223.1 or pUC Plasmid | CusabioGene Name: ACOT11Gene ID: 26027Accession Number: BC001517Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL855502HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ACOT11
- Gene ID:
- 26027
- Accession #:
- BC001517
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human ACOX3 cDNA Clone BC017053 pENTR223.1 or pUC Plasmid Human ACOX3 cDNA Clone BC017053 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/12061/20030/cusabio__81676.1638370075__31137.1639266853.jpg?c=1)
Human ACOX3 cDNA Clone BC017053 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human ACOX3 cDNA Clone BC017053 pENTR223.1 or pUC Plasmid | CusabioGene Name: ACOX3Gene ID: 8310Accession Number: BC017053Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL001174HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ACOX3
- Gene ID:
- 8310
- Accession #:
- BC017053
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human ACSM1 cDNA Clone BC125178 pENTR223.1 or pUC Plasmid Human ACSM1 cDNA Clone BC125178 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/12079/20048/cusabio__81676.1638370075__17476.1639266855.jpg?c=1)
Human ACSM1 cDNA Clone BC125178 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human ACSM1 cDNA Clone BC125178 pENTR223.1 or pUC Plasmid | CusabioGene Name: ACSM1Gene ID: 116285Accession Number: BC125178Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL600559HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ACSM1
- Gene ID:
- 116285
- Accession #:
- BC125178
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human ADAM2 cDNA Clone BC064547 pENTR223.1 or pUC Plasmid Human ADAM2 cDNA Clone BC064547 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/12136/20105/cusabio__81676.1638370075__84619.1639266861.jpg?c=1)
Human ADAM2 cDNA Clone BC064547 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human ADAM2 cDNA Clone BC064547 pENTR223.1 or pUC Plasmid | CusabioGene Name: ADAM2Gene ID: 2515Accession Number: BC064547Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL857465HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ADAM2
- Gene ID:
- 2515
- Accession #:
- BC064547
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human ACTA1 cDNA Clone BC012597 pENTR223.1 or pUC Plasmid Human ACTA1 cDNA Clone BC012597 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/12088/20057/cusabio__81676.1638370075__79531.1639266856.jpg?c=1)
Human ACTA1 cDNA Clone BC012597 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€214.00
Was:
Human ACTA1 cDNA Clone BC012597 pENTR223.1 or pUC Plasmid | CusabioGene Name: ACTA1Gene ID: 58Accession Number: BC012597Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL001205HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ACTA1
- Gene ID:
- 58
- Accession #:
- BC012597
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human ACCS cDNA Clone BC020197 pENTR223.1 or pUC Plasmid Human ACCS cDNA Clone BC020197 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/12045/20014/cusabio__81676.1638370075__74104.1639266851.jpg?c=1)
Human ACCS cDNA Clone BC020197 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human ACCS cDNA Clone BC020197 pENTR223.1 or pUC Plasmid | CusabioGene Name: ACCSGene ID: 84680Accession Number: BC020197Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL847213HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ACCS
- Gene ID:
- 84680
- Accession #:
- BC020197
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
![Human ACSF2 cDNA Clone BC014123 pENTR223.1 or pUC Plasmid Human ACSF2 cDNA Clone BC014123 pENTR223.1 or pUC Plasmid](https://cdn11.bigcommerce.com/s-rvypo0hmzw/images/stencil/590x590/products/12074/20043/cusabio__81676.1638370075__23431.1639266855.jpg?c=1)
Human ACSF2 cDNA Clone BC014123 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
MSRP:
Now:
€347.00
Was:
Human ACSF2 cDNA Clone BC014123 pENTR223.1 or pUC Plasmid | CusabioGene Name: ACSF2Gene ID: 80221Accession Number: BC014123Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL853397HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ACSF2
- Gene ID:
- 80221
- Accession #:
- BC014123
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC