Cusabio Customized Plasmid
Human C20orf30 cDNA Clone BC011990 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL853380HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- C20orf30
- Gene ID:
- 29058
- Accession #:
- BC011990
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human C20orf30 cDNA Clone BC011990 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: C20orf30
Gene ID: 29058
Accession Number: BC011990
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGATGCCGTCCCGTACCAACCTGGCTACTGGAATCCCCAGTAGTAAAGTGAAATATTCAAGGCTCTCCAGCACAGACGATGGCTACATTGACCTTCAGTTTAAGAAAACCCCTCCTAAGATCCCTTATAAGGCCATCGCACTTGCCACTGTGCTGTTTTTGATTGGCGCCTTTCTCATTATTATAGGCTCCCTCCTGCTGTCAGGCTACATCAGCAAAGGGGGGGCAGACCGGGCCGTTCCAGTGCTGATCATTGGCATTCTGGTGTTCCTACCCGGATTTTACCACCTGCGCATCGCTTACTATGCATCCAAAGGCTACCGTGCTTACTCCTATGATGACATTCCAGACTTTGATGACTAG
Length: 363
Related Products
Human C20orf30 cDNA Clone BC009768 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human C20orf30 cDNA Clone BC009768 pENTR223.1 or pUC Plasmid | CusabioGene Name: C20orf30Gene ID: 29058Accession Number: BC009768Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL853380HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- C20orf30
- Gene ID:
- 29058
- Accession #:
- BC009768
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human C20orf30 cDNA Clone BC009769 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human C20orf30 cDNA Clone BC009769 pENTR223.1 or pUC Plasmid | CusabioGene Name: C20orf30Gene ID: 29058Accession Number: BC009769Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL853380HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- C20orf30
- Gene ID:
- 29058
- Accession #:
- BC009769
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ABCA11P cDNA Clone BC098116 pENTR223.1 or pUC Plasmid | CusabioGene Name: ABCA11PGene ID: 79963Accession Number: BC098116Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL706339HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ABCA11P
- Gene ID:
- 79963
- Accession #:
- BC098116
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ABI2 cDNA Clone BC001439 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ABI2 cDNA Clone BC001439 pENTR223.1 or pUC Plasmid | CusabioGene Name: ABI2Gene ID: 10152Accession Number: BC001439Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL001102HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ABI2
- Gene ID:
- 10152
- Accession #:
- BC001439
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ACOT11 cDNA Clone BC001517 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ACOT11 cDNA Clone BC001517 pENTR223.1 or pUC Plasmid | CusabioGene Name: ACOT11Gene ID: 26027Accession Number: BC001517Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL855502HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ACOT11
- Gene ID:
- 26027
- Accession #:
- BC001517
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC