Cusabio Customized Plasmid
Human C17orf67 cDNA Clone BC093905 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL610369HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- C17orf67
- Gene ID:
- 339210
- Accession #:
- BC093905
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human C17orf67 cDNA Clone BC093905 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: C17orf67
Gene ID: 339210
Accession Number: BC093905
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGAAGACATTGCCTGTGCTCGTGCTGTCTCTTACCTTACTGACTGTCTTCTCAGAGACCTCCCCGATTTTGACAGAGAAGCAGGCCAAACAGCTCCTAAGATCTCGGCGACAGGATAGACCAAGCAAACCCGGATTCCCCGATGAGCCAATGCGGGAATACATGCACCACCTGCTCGCCCTGGAGCATCGCGCTGAGGAGCAGTTCCTGGAGCACTGGCTGAACCCTCACTGCAAACCCCACTGTGACAGGAACAGGATTCATCCTGTGTAA
Length: 273
Related Products
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€347.00
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid | CusabioGene Name: FZD2Gene ID: 2535Accession Number: BC113402Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL622766HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FZD2
- Gene ID:
- 2535
- Accession #:
- BC113402
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid | CusabioGene Name: G6PCGene ID: 2538Accession Number: BC130478Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009118HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC
- Gene ID:
- 2538
- Accession #:
- BC130478
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid | CusabioGene Name: FUNDC2Gene ID: 65991Accession Number: BC000255Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL861153HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FUNDC2
- Gene ID:
- 65991
- Accession #:
- BC000255
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid | CusabioGene Name: G6PC2Gene ID: 57818Accession Number: BC113376Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL873624HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC2
- Gene ID:
- 57818
- Accession #:
- BC113376
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FYCO1 cDNA Clone BC007218 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FYCO1 cDNA Clone BC007218 pENTR223.1 or pUC Plasmid | CusabioGene Name: FYCO1Gene ID: 79443Accession Number: BC007218Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL866262HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FYCO1
- Gene ID:
- 79443
- Accession #:
- BC007218
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC