Cusabio Customized Plasmid
Human ATP5J cDNA Clone BC066310 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL002369HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ATP5J
- Gene ID:
- 522
- Accession #:
- BC066310
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human ATP5J cDNA Clone BC066310 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: ATP5J
Gene ID: 522
Accession Number: BC066310
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGATTCTTCAGAGGCTCTTCAGGTTCTCCTCTGTCATTCGGTCAGCCGTCTCAGTCCATTTGCGGAGGAACATTGGTGTTACAGCAGTGGCATTTAATAAGGAACTTGATCCTATACAGAAACTCTTTGTGGACAAGATTAGAGAATACAAATCTAAGCGACAGACATCTGGAGGACCTGTTGATGCTAGTTCAGAGTATCAGCAAGAGCTGGAGAGGGAGCTTTTTAAGCTCAAGCAAATGTTTGGTAATGCAGACATGAATACATTTCACACCTTCAAATTTGAAGATCCCAAATTTGAAGTCATCGAAAAACCCCAGGCCTGA
Length: 327
Related Products
Human ATP5J cDNA Clone BC001178 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ATP5J cDNA Clone BC001178 pENTR223.1 or pUC Plasmid | CusabioGene Name: ATP5JGene ID: 522Accession Number: BC001178Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL002369HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ATP5J
- Gene ID:
- 522
- Accession #:
- BC001178
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€438.00
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM161B cDNA Clone BC037287 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM161B cDNA Clone BC037287 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM161BGene ID: 153396Accession Number: BC037287Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM161B
- Gene ID:
- 153396
- Accession #:
- BC037287
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM39A cDNA Clone BC003192 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM39A cDNA Clone BC003192 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM39AGene ID: 55254Accession Number: BC003192Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023834HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM39A
- Gene ID:
- 55254
- Accession #:
- BC003192
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM63A cDNA Clone BC030245 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€438.00
Human TMEM63A cDNA Clone BC030245 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM63AGene ID: 9725Accession Number: BC030245Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023865HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM63A
- Gene ID:
- 9725
- Accession #:
- BC030245
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TNFRSF14 cDNA Clone BC002794 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TNFRSF14 cDNA Clone BC002794 pENTR223.1 or pUC Plasmid | CusabioGene Name: TNFRSF14Gene ID: 8764Accession Number: BC002794Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL842173HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TNFRSF14
- Gene ID:
- 8764
- Accession #:
- BC002794
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMIGD2 cDNA Clone BC015655 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMIGD2 cDNA Clone BC015655 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMIGD2Gene ID: 126259Accession Number: BC015655Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL850263HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMIGD2
- Gene ID:
- 126259
- Accession #:
- BC015655
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC