The Functional Angiotensin Converting

Nevin Oruc1, Janette Lamb1, Onur Cagri Kutlu4, M Michael Barmada2, Mary E Money5,
Adam Slivka1, David C Whitcomb1,2,3
1Department of Medicine, Division of Gastroenterology, 2Human Genetics, 3Cell Biology and
Physiology, and the Center for Genomic Sciences, University of Pittsburgh. Pittsburgh, PA, USA.
4GATA Medical School, General Surgery Department. Ankara, Turkey. 5Washington County
Hospital. Hagerstown, MD, USA
ABSTRACT
Context Alterations of the renin-angiotensin
system have been implicated in the
pathogenesis of various diseases. The
angiotensin converting enzyme is a key
enzyme in the renin-angiotensin system. A
deletion polymorphism of a 287-bp fragment
of intron 16 of the angiotensin converting
enzyme gene allele results in higher levels of
circulating enzyme. ACE deletion genotype
has been linked to heart diseases, sarcoidosis
and liver fibrosis. The pancreatic renin-
angiotensin system plays a role in the
development of pancreatic fibrosis and ACE
inhibitors decrease pancreatic fibrosis in
experimental models.
Objectives We investigated the frequency of
the
ACE
gene
insertion/deletion
polymorphism in chronic pancreatitis patients
and controls.
Patients Subjects with familial pancreatitis
(n=51), sporadic chronic pancreatitis (n=104),
and healthy controls (n=163) were evaluated.
Main outcome measure The presence of
ACE insertion/deletion polymorphism.
Results The frequency of the ACE gene
deletion allele was similar in familial
pancreatitis (49.0%) sporadic pancreatitis
(51.0%) and controls (55.8%). Furthermore,
there was no significant difference in clinical
features between patients with ACE-insertion
or insertion/deletion genotypes vs. patients
with ACE-deletion genotype.
Conclusion We conclude that the ACE
deletion genotype does not make a significant
contribution to the pathogenesis and the
progression of chronic pancreatitis.
INTRODUCTION
Chronic pancreatitis is an inflammatory
disease which leads to pancreatic fibrosis and
the destruction of the exocrine and the
endocrine pancreas [1]. Pancreatitis appears
to be a complex disorder reflecting the
interaction of various genetic and
environmental factors [2, 3]. However, the
major common genetic risk factors have yet to
be defined.
The renin-angiotensin system (RAS) is a
circulatory cascade system primarily involved
in the regulation of blood pressure and serum

Page 2
JOP. J Pancreas (Online) 2004; 5(6):457-463.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 5, No. 6 – November 2004. [ISSN 1590-8577]
458
electrolytes [4, 5]. The key enzyme in this
system is the angiotensin converting enzyme
(ACE) which converts angiotensin I to the
potent vasoconstrictor angiotensin II [4, 5, 6].
The RAS has been said to be involved in the
pathogenesis of several diseases including
fibrosis in the heart, kidney, lung and liver
during chronic inflammation through the
regulation of cell growth, inflammation,
oxidative stress and fibrosis [7, 8, 9, 10].
The ACE gene insertion/deletion (I/D)
polymorphism was first identified in 1990
[11]. The ACE-D, a deletion polymorphism
of a 287-bp fragment of intron 16 of the ACE
gene allele, has been shown to result in higher
levels of circulating enzyme in a dose
dependent manner [11]. The role of the ACE
gene I/D polymorphism as a risk factor has
been investigated in several diseases. The
ACE deletion (DD) genotype, for example,
results in a 1.3 fold increased risk of
myocardial infarction [12]. Recent studies
have shown that the RAS is intrinsically
present in the pancreas [13] and its genetic
expression is enhanced during acute
pancreatitis and chronic pancreatic hypoxia in
experimental animals [14, 15]. Furthermore,
the pharmacological blockage of ACE
significantly attenuated pancreatic fibrosis in
an experimental model of chronic pancreatitis
in rats [16]. Thus ACE may have a pathogenic
role in the development of chronic
pancreatitis. However, the prevalence of the
ACE I/D polymorphism in chronic
pancreatitis and its contribution to the course
of the disease has not yet been defined. We
therefore investigated the occurrence of the
ACE I/D polymorphism in chronic
pancreatitis patients and its relationship to the
course of the disease.
METHODS
Patients
One hundred fifty five subjects were selected
from the institutional review board (IRB)
approved, Health Insurance Portability and
Accountability Act (HIPAA) compliant,
hereditary pancreatitis (HP) study and the
North American Pancreatitis Study 2
(NAPS2) pilot study which included a patient
group recruited through the University of
Pittsburgh Medical Center clinics. Fifty-one
cases had familial pancreatitis and 104 cases
had sporadic chronic pancreatitis. In addition,
163 healthy controls were evaluated. The
controls included spouses of affected
individuals from both studies or community-
based controls over 50 years of age who had
no prior history of digestive disease.
Data Recording
All subjects completed standardized
questionnaires assessing family history,
clinical history, environmental exposure
(including alcohol consumption and smoking
history) and detailed questions about recurrent
acute and chronic pancreatitis. The 155
patients selected also provided medical
records which included clinical notes,
operative notes, discharge summaries,
laboratory reports, abdominal imaging reports
and pathology reports that elucidated the
pattern of the pancreatic disease. The patient
information was used to categorize the
pancreatitis according to the etiology of
pancreatitis, the risk factors and the severity
of the disease.
Laboratory Procedure
Genomic DNA was purified from peripheral
blood cells of the subjects using a
commercially available kit (Puregene DNA
isolation kit, Gentra systems, Minneapolis,
MN, USA). The ACE genotype was
determined by PCR amplification of a
genomic DNA fragment on intron 16 of the
ACE gene as previously described by Rigat et
al. [11]. The forward and reverse primers
used
were
5-
CTGGAGACCACTCCCATCCTTTCT, and
5-GATGTGGCCATCACATTCGTCAGAT,
respectively. Amplified ACE gene fragments
without insertion (D allele) and with insertion
(I allele) of approximate 190 and approximate
490 bp, respectively, were detected on 1%
agarose gel containing ethidium bromide. To

Page 3
JOP. J Pancreas (Online) 2004; 5(6):457-463.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 5, No. 6 – November 2004. [ISSN 1590-8577]
459
increase the specificity of DD genotyping,
PCR amplifications were performed with an
insertion-specific
primer
pair
(5-
TGGGACCACAGCGCCCG CCACTAC and
5-TCGCCAGCCCTCCCATGCCCATAA),
with 25 µL reactions (0.5 µg genomic DNA,
500 pmol of primers, 0.5 mM each deoxy-
ATP, GTP, CTP, TTP, 1.5 mM MgCl2; 0.5 U
Taq DNA polymerase), with 1 min of
denaturation at 94°C, followed by 30 cycles
of 30 s at 94°C, 45 s at 67°C, and 2 min at
72°C. The reaction yields no products in the
samples of DD genotype [17]. Only the
insertion (I) allele produces a 335-bp
amplicon. The 335-bp fragment was
identified on 1.5% agarose gel containing
ethidium bromide.
ETHICS
The study was conducted with the approval of
Institutional Review Board of the University
of Pittsburgh. All patients and controls gave
written informed consent,
STATISTICS
The results were given as mean±SD or allele
frequencies. Data were analyzed by means of
the logistic regression, the one- and two-way
analysis of variance (ANOVA), and the
hierarchical log-linear models. The odds
ratios (OR) evaluated by the logistic
regression together with their 95% confidence
intervals (95% CI) were also reported. Two-
tailed P values of less than 0.05 were
considered statistically significant. The study
was powered to detect a relative risk of 3 in
the familial pancreatitis group of 88% and in
the sporadic chronic pancreatitis group of
97% (http://calculators.stat.ucla.edu/powercalc/)
RESULTS
A group of 51 familial pancreatitis patients
(39.1±18.2 years old; F/M: 38/13,
74.5%/25.5%), 104 sporadic chronic
pancreatitis (42.7±17.8 years old; F/M: 58/46,
55.8%/44.2%) and 163 healthy controls
(60.5±13.3 years old; F/M: 97/66,
59.5%/40.5%) were evaluated. The mean age
in the healthy controls was significantly
higher than in both the familial and the
sporadic chronic pancreatitis patients
(P<0.001), while no significant difference was
observed between the familial and the chronic
pancreatitis patients (P=0.181). The
comparison among the 3 groups showed a
significantly lower frequency of males in the
familial pancreatitis patients (P=0.029).
Table 1. Genotype distribution of the ACE gene in familial pancreatitis, chronic pancreatitis and healthy controls.
Familial
pancreatitis
(FP: n=51)
Sporadic
chronic pancreatitis
(SCP: n=104)
Healthy
controls
(HC: n=163)
Allele frequency
- I
26 (51.0%)
51 (49.0%)
72 (44.2%)
- D
25 (49.0%)
53 (51.0%)
91 (55.8%)
FP and SCP vs. HC: OR of D (95% CI)
P value
0.76 (0.41-1.43)
P=0.395
0.82 (0.50-1.35)
P=0.437
-
FP vs. SCP: OR of D (95% CI)
P value
0.93 (0.47-1.81)
P=0.820
-
ACE
- II
15 (29.4%)
26 (25.0%)
33 (20.2%)
- ID
22 (43.1%)
49 (47.1%)
78 (47.9%)
- DD
14 (27.5%)
29 (27.9%)
52 (31.9%)
FP and SCP vs. HC: OR of DD (95% CI)
P value
0.81 (0.40-1.62)
P=0.549
0.83 (0.48-1.42)
P=0.487
-
FP vs. SCP: OR of DD (95% CI)
P value
0.98 (0.46-2.07)
P=0.955
-
Logistic regression analysis

Page 4
JOP. J Pancreas (Online) 2004; 5(6):457-463.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 5, No. 6 – November 2004. [ISSN 1590-8577]
460
The distribution of the ACE genotype is
summarized in Table 1. There were no
significant differences in allele distribution
among the three groups (overall P=0.601); the
ACE-D allele frequency in familial
pancreatitis patients (49.0%) was not
significantly different (P=0.395) in
comparison to controls (55.8%), while the
sporadic chronic pancreatitis patients had a
51.0% ACE-D allele frequency (P=0.820 and
P=0.437 vs. familial pancreatitis and controls,
respectively). Familial pancreatitis cases,
chronic pancreatitis cases and controls had a
similar ACE-DD genotype frequency (overall
P=0.720 among the 3 groups): 27.5% (14/51),
27.9% (29/104), and 31.9% (52/163),
respectively (Table 1).
The clinical features of patients with different
ACE genotypes are summarized in Table 2.
The mean age of the disease onset was
27.5±17.9 in familial pancreatitis cases and
39.4±14.6 in sporadic pancreatitis cases
(P<0.001). There was a significantly lower
frequency of both male sex (25.5% vs. 44.2%;
P=0.022) and calcification (15.7% vs. 30.8%;
P=0.037) in patients with familial pancreatitis
in comparison to those with sporadic chronic
pancreatitis, while no significant differences
were detected between patients with ACE-DD
and ACE II/ID genotypes (P<0.595, P=0.361,
and P=0.640 for age of the disease onset,
gender and calcification, respectively).
Surgical intervention was reported in 12 of
the 51 familial pancreatitis cases and in 19 of
the 104 sporadic pancreatitis cases due to
pancreatitis-related complications. Endocrine
insufficiency was present in 3 familial
pancreatitis cases of whom none had the
ACE-DD genotype and 12 sporadic
pancreatitis cases of whom two had the ACE-
DD genotype (Table 2). Ten out of 32
sporadic pancreatitis cases with pancreatic
calcifications have ACE-DD genotype. None
of the familial cases with the ACE-DD
genotype had pancreatic calcification.
Pancreatic duct abnormalities were reported
in 28 sporadic and 11 familial cases. There
was no significant relationship between the
ACE genotype and pancreatic imaging
findings (Table 2).
In sporadic chronic pancreatitis subjects,
44.8% of patients with the DD genotype
reported severe pain attacks vs. 53.5% of
patients with the ID or II genotype (13/29 DD
vs. 40/75 II/ID). Those ratios were 57.1% and
48.6% (8/14 DD vs. 18/37 II/ID) in familial
pancreatitis cases, respectively. The
differences between the ratios were not
significant (P=0.437 and P=0.589 in the
sporadic chronic pancreatitis and the familial
pancreatitis patients, respectively).
DISCUSSION
The RAS, traditionally known as an endocrine
system regulating blood pressure and body
fluid homeostasis [18], is also a mediator of
normal and pathophysiological processes in a
Table 2. Phenotypic characteristics of sporadic and familial pancreatitis cases grouped according to their ACE
genotype.
Familiary
pancreatitis
(FP, n=51)
Sporadic chronic
pancreatitis
(SCP, n=104)
Significance
ACE
II/ID
(n=37)
ACE
DD
(n=14)
ACE
II/ID
(n=75)
ACE
DD
(n=29)
DD
vs.
II/ID
FP
vs.
SCP
Gender (male/female)
8/29
5/9
33/42
13/16
0.361a
0.022a
Mean age of onset (years)
29.1±17.1 23.3±20.0
39.3±18.5 39.5±19.1
0.595b
<0.001b
Pancreatic surgery
7 (18.9%) 5 (35.7%)
16 (21.3%) 3 (10.3%)
0.789a
0.447a
Endocrine insufficiency
3 (8.1%)
0 (0%)
10 (13.3%) 2 (6.9%)
0.156a
0.240a
Imaging findings:
- Calcification
8 (21.6%)
0 (0%)
22 (29.3%) 10 (34.5%)
0.640a
0.037a
- Pseudocysts
6 (16.2%) 2 (14.3%)
8 (10.7%) 1 (3.4%)
0.305a
0.199a
- MPD abnormalities
7(18.9%) 4 (28.6%)
22 (29.3%) 6 (20.7%)
0.731a
0.465a
aHierarchical log-liner models (adjusted for ACE genotype)
bTwo-way ANOVA

Page 5
JOP. J Pancreas (Online) 2004; 5(6):457-463.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 5, No. 6 – November 2004. [ISSN 1590-8577]
461
variety of tissues [19]. The ACE plays a
central role in this system by converting
angiotensin I to the potent vasoconstrictor
angiotensin II [20]. Angiotensin II stimulates
the proliferation of mesangial cells, cardiac
fibroblasts, and hepatic stellate cells and
increases the synthesis of extracellular matrix
proteins [8, 9, 10, 21]. Thus, RAS is involved
in the pathogenesis of fibrosis in tissues
including kidney, heart and liver [7, 8, 9, 10].
The deletion type polymorphism in the 16th
exon of the ACE gene is associated with
elevated serum and cellular ACE levels. The
ACE DD genotype is associated with several
disorders including cardiac and renal diseases
[12, 17] although the magnitude of this
association has been questioned [22].
However, the pathological risk of ACE DD
genotypes also varies between populations
with different genetic and environmental
backgrounds [23], suggesting that the ACE
DD genotype is acting as a disease modifier
rather than as a disease susceptibility factor.
The RAS system has been shown to play an
important role in the regulation of pancreatic
exocrine and endocrine functions [24]. During
acute and chronic inflammation of the
pancreas, both circulating ACE activity and
intrinsic pancreatic ACE activity is markedly
elevated [15, 25, 26]. Recently, Nagashio et
al. reported that an ACE directs pancreatic
fibrogenesis in experimental animals [27].
Moreover, the inhibition of the RAS with an
ACE inhibitor attenuates pancreatic fibrosis in
an animal model of chronic pancreatitis [16],
suggesting that RAS might play an important
role in pancreatic fibrosis. Therefore, we
hypothesized that functional the ACE-I/D
polymorphism might be a genetic risk factor
for chronic pancreatitis
This is the first report investigating a potential
role of the ACE polymorphism in the
susceptibility or progression of chronic
pancreatitis. There are notable differences in
the distributions of the ACE genotype within
and between different populations [28, 29]. In
our study, ACE gene I/D allele frequency is
similar to previously reported frequencies in
American populations [30]. In order to
estimate the contribution of the ACE
polymorphism to the course of chronic
pancreatitis, the clinical signs and symptoms
were compared between patients with
different ACE genotypes. In contrast to the
published studies in renal failure patients [31],
the chronic pancreatitis phenotype did not
differ between patients with ACE- DD, II or
ID genotypes.
Although the RAS participates in the
development and the progression of chronic
pancreatitis and the inhibition of the ACE
appears to improve outcome in some animal
models,
the
functional
ACE-DD
polymorphism did not appear to influence the
susceptibility or the course of chronic
pancreatitis in our human study. Several
possible explanations were considered: 1) the
ACE DD genotype may influence the
expression of the ACE in the heart and
kidneys but not in the pancreas; 2) the ACE
DD genotype may modify the progression of
chronic pancreatitis, but this was not detected
due to the insensitivity of phenotyping the
rate of disease progression in chronic
pancreatitis; 3) ACE DD genotypes are an
important cofactor in a gene-gene or gene-
environment model which has not yet been
resolved, or 4) other RAS-associated enzymes
may be more important in the pancreas than
the ACE within the pancreas (e.g. portions of
the pathway may be bypassed and distal steps
in the system activated by digestive enzymes
such as trypsin [32]). However, the current
results suggest that factors other than ACE
expression levels may be important in
regulating the RAS system within the
pancreas. The fact that the RAS system
specifically affects the pancreas also suggests
that local, rather than systemic effects, are
important in pancreatic diseases.
In conclusion, although the RAS system
seems to play a role in the development of
pancreatic inflammation and fibrosis, the
ACE I/D polymorphism does not play a
dominant role in the pathogenesis and the
progression of chronic pancreatitis.
Received July 14th, 2004 - Accepted
September 7th, 2004

Page 6
JOP. J Pancreas (Online) 2004; 5(6):457-463.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 5, No. 6 – November 2004. [ISSN 1590-8577]
462
Keywords
Pancreatitis; Polymorphism
(Genetics); Renin-Angiotensin System
Abbreviations ACE: angiotensin converting
enzyme; HIPAA: the Health Insurance
Portability and Accountability Act; HP:
hereditary pancreatitis; IRB: institutional
review board; NAPS2: North American
Pancreatitis Study 2; RAS: renin angiotensin
system
Acknowledgements
This work was
supported by NIH Grant DK061451 (DCW)
and by a scholarship from the Turkish
Gastroenterology Association (NO)
Correspondence
David C Whitcomb
Division of Gastroenterology, Hepatology and
Nutrition
Mezz. Level, C Wing, UPMC Presbyterian
200 Lothrop St.
Pittsburgh, PA
USA
 
References
1. Ammann RW, Akovbiantz A, Largiader F,
Schueler G. Course and outcome of chronic
pancreatitis. Longitudinal study of a mixed medical-
surgical series of 245 patients. Gastroenterology 1984;
86:820-8. [PMID 6706066]
2. Whitcomb DC. Hereditary pancreatitis. New
insights into acute and chronic pancreatitis. Gut 1999;
45:317-22. [PMID 10446089]
3. Whitcomb DC, Gorry MC, Preston RA, Furey W,
Sossenheimer MJ, Ulrich CD, et al. Hereditary
pancreatitis is caused by a mutation in the cationic
trypsinogen gene. Nat Genet 1996; 14:141-5. [PMID
8841182]
4. Stroth U, Unger T. The renin angiotensin system
and its receptors. J Cardiovascular Pharmacol 1999;
33:S21-8. [PMID 10028950]
5. Pueyo ME, N`Diaye N, Michael JB. Angiotensin
II elicited signal trans-duction via AT 1 receptors in
endothelial cells. Br J Pharmacol 1996; 118:79-84.
[PMID 8733579]
6. Mii S, Ware JA, Mallette SA, Kent KC. Effect of
angiotensin II on human vascular smooth muscle cell
growth. J Surg Res 1994; 57:174-8. [PMID 8041134]
7. Frishman WH, Fozailoff A, Lin C, Dike C. Renin
inhibition: a new approach to cardiovascular therapy. J
Clin Pharmacol 1994; 34:873-80. [PMID 7983230]
8. Ruiz-Ortega M, Ruperez M, Esteban V, Egido J.
Molecular mechanisms of angiotensin II-induced
vascular injury. Curr Hypertens Rep 2003; 5:73-9.
[PMID 12530939]
9. Bataller R, Gines P, Nicolas JM, Gorbig MN,
Garcia Ramealo E, Gasull X, et al. Angiotensin II
induces contraction and proliferation of human hepatic
stellate cells. Gastroenterology 2000; 118:1149-56.
[PMID 10833490]
10. Marshall RP, McAnulty RJ, Laurent GJ.
Angiotensin II is mitogenic for human lung fibroblasts
via activation of the type 1 receptor. Am J Respir Crit
Care Med 2000; 161:1999-2004. [PMID 10852780]
11. Rigat B, Hubert C, Alhenc-Gelas F, Corvol P,
Soubrier F. An insertion/ deletion polymorphism in
angiotensin converting enzyme gene accounting for
half the variance of serum enzyme levels. J Clin Invest
1990; 86:1343-6. [PMID 1976655]
12. Cambien F, Poirier O, Lecerf L, Evans A, Cambou
JP, Arveiler D, et al. Deletion polymorphism in the
gene for angiotensin converting enzyme is a potent risk
factor for myocardial infarction. Nature 1992; 359:641-
4. [PMID 1328889]
13. Nobiling R. The renin-angiotensin system: from
the renal basis to an organ-specific subsystem in the
pancreas. JOP. J Pancreas (Online) 2001; 2:9-12.
[PMID 11862016]
14. Leung PS, Chappell MC. A local pancreatic renin-
angiotensin system: endocrine and exocrine roles. Int J
Biochem Cell Biol 2003; 35:838-46. [PMID 12676170]
15. Chan WP, Fung ML, Nobiling R, Leung PS.
Activation of local renin-angiotensin system by chronic
hypoxia in rat pancreas. Mol Cell Endocrinol 2000;
160:107-14. [PMID 10715544]
16. Kuno A, Yamada T, Masuda K, Ogawa K, Sogawa
M, Nakamura S, et al. Angiotensin- Converting
Enzyme attenuates pancreatic inflammation and
fibrosis in male Bonn/Kabori rats. Gastroenterology
2003; 124:1010-9. [PMID 12671898]
17. Yoshida H, Mitarai T, Kawamura T, Kitajima T,
Miyazaki Y, Nagasawa R, et al. Role of deletion
polymorphism of the angiotensin converting enzyme
gene in the progression and therapeutic responsiveness
of IgA nephropathy. J Clin Invest 1995; 96:2162-9.
[PMID 7593601]
18. Oparil S, Haber E. The renin-angiotensin system
(first of two parts). N Engl J Med 1974; 291:389-401.
[PMID 4367917]

Page 7
JOP. J Pancreas (Online) 2004; 5(6):457-463.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 5, No. 6 – November 2004. [ISSN 1590-8577]
463
19. Matsusaka T, Hymes J, Ichikawa I. Angiotensin in
progressive renal diseases: theory and practice. J Am
Soc Nephrol 1996; 7:2025-43. [PMID 8915963]
20. Matsusaka T, Ichikawa I. Biological functions of
angiotensin and its receptors. Annu Rev Physiol 1997;
59:395-412. [PMID 9074770]
21. Moriguchi Y, Matsubara H, Mori Y, Murasawa S,
Masaki H, Maruyama K, et al. Angiotensin II induced
transactivation of epidermal growth factor receptor
regulates fibronectin and transforming growth factor
beta
synthesis
via
transcriptional
and
posttranscriptional mechanisms. Circ Res 1999;
84:1073-84. [PMID 10325245]
22. Ioannidis JP, Trikalinos TA, Ntzani EE,
Contopoulos-Ioannidis DG. Genetic associations in
large versus small studies: an empirical assessment.
Lancet 2003; 361:567-71. [PMID 12598142]
23. Baudin B. New aspects on angiotensin converting
enzyme : from gene to disease. Clin Chem Lab Med
2002; 40:256-65. [PMID 12005216]
24. Leung PS Carlsson PO. Tissue renin- angiotensin
system: its expression, localization, regulation and
potential role in the pancreas. J Mol Endocrinol 2001;
26:155-164. [PMID 11432370]
25. Leung PS, Chan HC, Nobiling R. Regulated
expression of pancreatic renin angiotensin system in
experimental pancreatitis. Mol Cell Endocrinol 2000;
166:121-128. [PMID 10996430]
26. Ip SP, Kwan PC, Williams CH, Pang S, Hooper
NM, Leung PS. Changes of angiotensin converting
enzyme activity in the pancreas of chronic hypoxia and
acute pancreatitis. Int J Biochem Cell Biol 2003;
35:944-54. [PMID 12676178]
27. Nagashio Y, Asaumi H, Watanabe S, Nomiyama
Y, Taguchi M, Tashiro M, et al. Angiotensin II type 1
receptor interaction is an important regulator for the
development of pancreatic fibrosis in mice. Am J
Physiol Gastrointest Liver Physiol 2004; 287:170-7.
[PMID 15016612]
28. O`Malley J, Maslen CL, Illingworth DR.
Angiotensin converting enzyme DD genotype and
cardiovascular disease in heterozygous familial
hypercholesterolemia. Circulation 1998; 97:1780-3.
[PMID 9603531]
29. Pietinalho A, Furuya K, Yamaguchi E, Kawakami
Y, Selroos O. The angiotensin converting enzyme DD
gene is associated with poor prognosis in Finnish
sarcoidosis patients. Eur Resp J 1999; 13:723-6.
[PMID 10362030]
30. Beohar N, Damaraju S, Prather A, Yu QT, Raizner
A, Kleiman ND, et al. Angiotensin-I converting
enzyme genotype DD is a risk factor for coronary
artery disease. J Investig Med 1995; 43:275-80. [PMID
7614074]
31. Navis G, van der Kleij FG, de Zeeuw D, de Jong
PE. Angiotensin-converting enzyme gene I/D
polymorphism and renal disease. J Mol Med 1999;
77:781-91. [PMID 10619438]
32. Ohta T, Amaya K, Yi S, Kitagawa H, Kayahara M,
Ninomiya I, et al. Angiotensin converting enzyme-
independent, local angiotensin II-generation in human
pancreatic ductal cancer tissues. Int J Oncol 2003;
23:593-8. [PMID 1288889

There are no products listed under this category.