Neurotrophins and Neurotrophin

Paolo Bonini1, Daniela Pierucci1, Simona Cicconi1, Ottavia Porzio1, Renato Lauro1, Lionel NJL
Marlier1,2, Patrizia Borboni1
1Laboratory of Molecular Medicine, Department of Internal Medicine, University of Rome “Tor
Vergata”. Rome, Italy. 2National Research Council (CNR), Institute of Neurobiology and Molecular
Medicine (INeMM). Rome, Italy
ABSTRACT
Context It is worth noting that islets and
betaTC6-F7 cells share a common pattern of
expression of neurotrophins and neurotrophin
receptors. Recently, several studies have
hypothesized a role for nerve growth factor in
pancreatic development and maturation,
suggesting that nerve growth factor may be a
survival factor for pancreatic beta-cells.
Objective The aim of the present study was to
investigate the pattern of expression of
neurotrophins and their relative receptors both
in rat pancreatic islets and in a wide panel of
insulinoma cell lines.
Main outcome measures A semi-quantitative
reverse-transcription polymerase chain reaction
analysis was performed on ribonucleic acids
extracted from these cell.
Results Reverse transcription-polymerase chain
reaction analysis demonstrates that brain-
derived neurotrophic factor, as well as
neurotrophins 3 and 4, are expressed both in
islets and in all insulinoma cells, while nerve
growth factor is expressed only in islets,
betaTC6-F7 cells and, at a low level, in RIN
1046-38 cells. Receptors protein tyrosine kinase
A and C are ubiquitously expressed both in
islets and insulinoma cells. Tyrosine kinase B is
absent in HIT-T15 cells.
Conclusions These data indicate that betaTC6-
F7 cells are a suitable model for studying the
role of neurotrophins in the survival of beta-
cells.
INTRODUCTION
It has recently been demonstrated that
pancreatic beta-cells express functional
receptors for nerve growth factor (NGF) and
that NGF exerts some effects on beta-cells such
as the induction of neuron-like differentiation,
the stimulation of sodium current and the
enhancement of early responsive gene
expression (i.e. NGF-1A and c-fos) [1, 2, 3, 4,
5]. NGF exerts its biological effects on
neuronal cells through specific cell surface
receptors: p75NTR (p75), which is the low
affinity NGF receptor whose function has not
yet been completely elucidated, and gp140Trk-A
(Trk-A, tyrosine-receptor kinase A), which is
the high affinity NGF receptor which combines
with p75NGFR to form a receptor complex with
full biological activity [6]. The expression of
both high- and low-affinity receptors for NGF

Page 2
JOP. J. Pancreas (Online) 2001; 2(3):105-111.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 3 – May 2001
106
has been demonstrated in different insulinoma
cell lines and in fetal rat islets, while the
expression of Trk-A has been also
demonstrated in adult islets [7, 8]. The cellular
localization of Trk-A and NGF is
developmentally regulated, suggesting that the
neurotrophin system may play an important role
in beta-cell development. Little is known about
the expression and role of the other
neurotrophins and their relative receptors in
pancreatic beta cells [3, 5, 9].
The aim of the present study was to
characterize the pattern of expression of
neurotrophins and their receptors in pancreatic
beta-cells and in pertinent insulinoma cell lines
expression.
METHODS
Cells Cultures
Islet preparations were obtained from6-month-
old mice. The pancreases were excised from 3
mice and digested as previously described [10].
Subsequently the islets were handpicked under
a stereomicroscope. Cells, free of exocrine
tissue, were cultured in Rosweli Park Memorial
Institute (RPMI) 1640 medium (Gibco-BRL,
Gaithersburg, MD, USA) as previously
described [10].
BetaTC6-F7 cells (kindly provided by Dr.
Shimon Efrat, Tel Aviv University, Israel)
obtained from transgenic mice expressing SV40
large-T antigen under control of the insulin
promoter, were cultured in Dulbecco’s
modified Eagle’s medium (DMEM, Gibco-
BRL, Gaithersburg, MD, USA) supplemented
with 15% horse serum (HS), 5% fetal calf
serum (FCS) and 2 mM glutamine and used at
passages 35-50 where physiological glucose
responsiveness is maintained [11]. RIN 1046-
38 cells were cultured in M199 medium
(Gibco-BRL, Gaithersburg, MD, USA)
supplemented with 10% FCS and 2mM
glutamine. RIN cells were used at passages 19-
25 in which glucose responsiveness is
maintained [12]. INS-1 cells (passages 85-92)
were cultured in RPMI 1640 medium, 1 mM
sodium pyruvate, 50 µM beta-mercaptoethanol,
10% FCS and 5% HS. HIT-T15 cells (passages
72-82), a clonal hamster cell line, were cultured
in RPMI 1640 medium supplemented with 10%
FCS and 2.5 µg amphotericin B.
All the culture media contained 11.1 mmol
glucose, 50 IU penicillin and 50 µg/mL
streptomycin. Cells were subcultured once a
week and maintained at 37 °C in an atmosphere
of 95% humidified air and 5% CO2.
RNA Preparation and RT-PCR Analysis
RNA was extracted by the guanidium
thiocyanate method [13] and used for reverse
transcription–polymerase chain reaction
analysis (RT-PCR). Briefly, 1 µg RNA was
reverse transcribed for 1 hour at 42 °C using
200 U Moloney murine leukemia virus
(MMLV) reverse transcriptase (Gibco-BRL,
Gaithersburg, MD) in the presence of 2.5 µM
random hexamers and 200 µM nucleotides
(Amersham Pharmacia Biotech, Cologno
Monzese, MI, Italy) in 20 µL final volume.
Successively, 2 µL of each cDNA were PCR
amplified using 2.5 U Platinum Taq except for
p75NTR for which 2.5 U Hot Start (Qiagen SpA,
Milan, Italy), was used in the presence of 15
pmol of specific primers. To normalize cDNA
amounts used during the PCR amplification, a
parallel amplification was performed using
glyceraldehyde-3-phosphate dehydrogenases
(GAPDH) specific primers (not shown).
After a 5 min denaturation step, PCR cycles
consisted of 30 sec denaturation, 30 sec
annealing and 1 min extension (5 min final
extension) were performed using a Perkin
Elmer 2400 thermal cycler (Perkin Elmer
Corporation, Norwalk, CN, USA). The number
of cycles depended on the relative abundance of
each target analyzed and is indicated below.
Primer sequences were as follows: NGF
forward 5’-AAGGACGCAGCTTTCTATAC
and reverse 5'-TGTGGAAGACTGGGTGGGT

Page 3
JOP. J. Pancreas (Online) 2001; 2(3):105-111.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 3 – May 2001
107
(60 cycles); brain-derived neurotrophic factor
(BDNF)
forward
5'-
ATGGGACTCTGGAGAGCGTGAA
and
reverse 5'-CGCCAGCCAATTCTCTTTTTGC
(50 cycles); neurotrophins 3 (NT3) forward 5'-
CTTATCTCCGTGGCATCCAAGG
and
reverse 5'-TCTGAAGTCAGTGCTCGGACGT
(55 cycles); neurotrophins 4 (NT4) forward 5'-
TTCTGGCTCCTGAGTGGAC and reverse 5'-
AGTCAACGCCCG-CACATAG (50 cycles);
Trk-A
forward
5'-
GTGCTCAATGAGACCAGC-TTC
and
reverse 5'-CTTCAGTGCCCTTGACAGCCAC
(50
cycles);
Trk-B+
forward
5'-
TACTGGGACGTTGGGAATTTGG
and
reverse 5'-CCCTCTTCAGAACGATGTTGTG
(45
cycles);
Trk-B-
forward
5'-
TACTGGGACGT-TGGGAATTTGG
and
reverse 5'-CCTTTATCTCAGCTACCCATCC
(60
cycles);
Trk-C
forward
5'-
TGGACTGGATAGTCACTGG and reverse 5’-
TGGGTCACAGTGATAGGAG (45 cycles);
p75 forward 5'-GAGCCACCAGAGCGTGTG
and reverse 5'-GGGGATGTGGCAGTGGAC
(60 cycles). The number of cycles indicated
were used in pilot experiments to allow PCR
amplification in the linear range.
ETHICS
Animals used for islet preparations received
humane care according to the standard criteria
outlined in the “Guide for the Care and Use of
Laboratory Animals” as prepared by the
National Academy of Sciences.
STATISTICS
No statistical evaluation of the data was
performed due to the qualitative nature of this
study.
RESULTS
RT-PCR analysis demonstrated a cell-specific
pattern of neurotrophin/neurotrophin receptor
expression (Figure 1). In particular, NGF
mRNA expression is virtually limited to islets
and betaTC6-F7 cells. It is barely detectable in
RIN and undetectable in the other cell lines.
Figure 1. RT-PCR analysis. The marker on the left is a
1Kbladder (Gibco).
NGF
BNDF
NT3
NT4
Trk-A
TrKB
+
Trk-B
-
Trk-C
p75

Page 4
JOP. J. Pancreas (Online) 2001; 2(3):105-111.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 3 – May 2001
108
BDNF and NT4 mRNA expression is present in
all groups. NT3 mRNA is expressed in all
groups but is barely detectable in betaTC6-F7
cells.
Concerning the pattern of neurotrophin receptor
expression, Trk-A mRNA is uniformly
expressed, although less so in islets and
betaTC6-F7 cells. Trk-B+
mRNA is not
expressed in islets and in HIT-T15 cells while
Trk-BmRNA is absent in HIT-T15 cells and
barely detectable in islets; TrkC mRNA is
expressed in all groups, although to a lesser
degree represented in RIN cells. Finally, p75
mRNA is expressed in islets and in all the cell
lines, and is less abundant in RIN and HIT
cells.
Although this was not a quantitative study, the
amount of RNA from each cell line used for
RT-PCR was normalized. Therefore the
amplitude of bands and the number of PCR
cycles applied to get uniform bands for a given
target are consistent with differences in the
mRNA contents. In particular, NGF mRNA
required 60 cycles while BDNF or NT4
required only 50 cycles to obtain a comparable
signal. Similarly, p75 was clearly detectable
after 40 cycles, while the kinase minus isoform
of Trk-B required 60 cycles.
DISCUSSION
The family of neurotrophic factors includes
NGF, the first neurotrophin identified, BDNF,
NT3 and NT4. Signal transduction by these
neurotrophins is initiated by binding to specific
high affinity tyrosine-kinase receptors, called
Trk-A for NGF and NT3, Trk-B for BDNF and
Trk-C for NT4. All the neurotrophins interact
with the low affinity receptor p75, whose role
in the neurotrophin signal transduction is not
completely elucidated [14].
NGF and BDNF are expressed in a limited
number of peripheral tissues [15]; in particular
NGF has been detected in lymphocytes and
pancreatic betacells [3, 16], while BDNF has
been identified in dorsal root ganglia [17]. On
the contrary, NT3 is almost omnipresent being
localized in the heart, kidney, gut, lung, spleen,
liver, muscle, skin, secretory cells of the
submandibular gland and epithelial cells of
secondary and tertiary follicles in the ovary
[18].
Neurotrophin 4/5 (NT4/5) is a member of the
neurotrophin family known to influence
survival and to have other effects on a variety
of neuronal cells. Although NT4/5 mRNA has
been found in various effector tissues of the rat
and human, the concentration of NT4/5 protein
in tissues has not been previously reported due
to the lack of a suitable methodology. A
recently developed quantitative two-site
enzyme-linked immunosorbent assay for the
estimation of NT4/5 in pre- and postnatal rat
tissues showed that NT4/5 is present in most
embryonic tissues but was rarely detectable in
postnatal tissues, with the notable exception of
the testis [19].
Previous studies have demonstrated the
expression of high- and low-affinity receptors
for NGF in pancreatic islets and in various beta-
cell lines as well as in numerous non-neuronal
tissues by both Northern blot analysis and
binding studies [1, 3, 4, 9, 20]. Trk-B receptor
has been found only in truncated forms in non-
neural tissues such as the spleen,
submandibular gland, testes, kidney and
pituitary gland [21]. On the contrary, Trk-C has
been found in the thymus, lung, kidney,
stomach and testes with discordant data
regarding findings of truncated or full-length
receptor forms. Recently the presence of full-
length Trk-C mRNA and protein has been
demonstrated in INS-1 cells, where NT3
determines an increase in intracellular free
calcium and is not followed by changes in
insulin secretion [22].
The present study points out that in islets the
pattern of neurotrophin/neurotrophin receptor
expression includes all the neurotrophins with
Trk-A and C mRNAs. On the contrary, in the
beta-cell lines, NGF mRNA expression is
lacking except in betaTC6-F7 cells. In RIN

Page 5
JOP. J. Pancreas (Online) 2001; 2(3):105-111.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 3 – May 2001
109
cells it is expressed at a very low level. Trk-A
and C are omnipresent, even though less
abundant in RIN cells, while Trk-B is lacking
in HIT cells. Finally, islets express the low
affinity receptor for NGF as well as betaTC6-
F7 cells and RIN cells, while it is less abundant
in INS and HIT cells.
These data suggest that islets and betaTC6-F7
cells share a common pattern of neurotrophin
expression which is unusual as compared to the
other tested cell lines tested due to the presence
of NGF. Similarly, islets share a common
pattern of expression with INS-1 and HIT cells
relative to the NT3/TrkC axis.
We hypothesize that NGF and NT3 can act at
the level of pancreatic betacells by
independent autocrine loops which can be
relevant for beta-cell functioning and we
suggest that betaTC6-F7 cells represent a
unique model for studies on the NGF
mechanism of action. In addition, INS-1 and
HIT-T15 cells are useful tools for studies of the
mechanism of action of NT3.
Considerable evidence has recently been
provided indicating a role for NGF in pancreas
development and maturation. In fact, it has
been demonstrated that inhibition of the
tyrosine-kinase activity of the NGF receptors
causes an impairment of islet morphogenesis
[4]; NGF receptor expression in beta-cells is
regulated by prolactin and/or the growth
hormone, two hormones which are involved in
pancreas development and betacell function
[23]. Furthermore, NGF has been demonstrated
to induce neuron-like differentiation in beta-
cells [5, 9, 24]. Finally, NGF increases
gp140Trk-A expression in islets, suggesting that
the NGF autocrine effects are mediated through
activation of gp140Trk-A [2]. The role of p75NTR
in beta-cells has not yet been clarified. The
NGF low affinity receptor is considered to be
involved
in
the
modulation
of
apoptosis/survival in neurons which is
consistent with its structural similarity to
Fas/Apo-1, tumor necrosis factor receptors I
and II and CD40 [25, 26, 27] . Based on these
data, it can be hypothesized that NGF plays a
role in the modulation of apoptosis/survival of
islet beta-cells. Beta cell susceptibility to
apoptosis influences the occurrence of diabetes
by reducing the beta-cell mass [28, 29] .
Therefore, the understanding of the
mechanisms influencing this highly regulated
process is extremely important.
In conclusion, we have characterized the
neurotrophin/neurotrophin receptor pattern of
expression in a panel of betacells, providing
basic information as to the possible role of
neurotrophic factors in the regulation of
betacell apoptosis/survival. Furthermore, we
have determined the cellular models useful for
studies in this field.
Received March 12th, 2001 – Accepted April
20th, 2001
Key words Insulinoma; Islets of Langerhans;
Nerve Growth Factor; Polymerase Chain
Reaction
Abbreviations
BDNF:
brain-derived
neurotrophic factor; DMEM: Dulbecco’s
modified Eagle’s medium; FCS: fetal calf
serum; GAPDH: glyceraldehyde-3-phosphate
dehydrogenases; HS: horse serum; MMLV:
Moloney murine leukemia virus; NT:
neurotrophins; RPMI: Rosweli Park Memorial
Institute; Trk: tyrosine-receptor kinase
Acknowledgements This work was supported
by grants from MURST (60% 1998 and “Cofin
1998”) and research fellowships to PB, DP and
SC.
Correspondence
Patrizia Borboni
Laboratory of Molecular Medicine
Department of Internal Medicine
University of Rome “Tor Vergata”
Via di Tor Vergata, 125
00136 Rome

Page 6
JOP. J. Pancreas (Online) 2001; 2(3):105-111.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 3 – May 2001
110
Italy
Phone: +39-06-7259.6530
Fax: +39-06-7259.6538
E-mail address: borboni@uniroma2.it
References
1. Miralles F, Philippe P, Czernichow P, Scharfmann
R. Expression of nerve growth factor and its high-affinity
receptor Trk-A in the rat pancreas during embryonic and
fetal life. J Endocrinol 1998; 156:431-9. [98243305]
2. Rosenbaum T, Vidaltamayo R, Sanchez-Herrera D,
Hiriart M. Nerve growth factor increases sodium current
in pancreatic beta cells. J Membr Biol 1996; 153:53-8.
[96350962]
3. Rosenbaum T, Vidaltamayo R, Sanchez-Soto MC,
Zentella A, Hiriart M. Pancreatic beta cells synthesize
and secrete nerve growth factor. Proc Natl Acad Sci USA
1998; 95:7784-8. [98301653]
4. Kanaka-Gantenbein C, Dicou E, Czernichow P,
Scharfmann R. Presence of nerve growth factor and its
receptors in an in vitro model of islet cell development:
implication
in
normal
islet
morphogenesis.
Endocrinology 1995; 136:3154-62. [95309212]
5. Polak M, Scharfmann R, Seilheimer B, Eisenbarth
G, Dressler D, Verma IM, Potter H. Nerve growth factor
induces neuron-like differentiation of an insulin-secreting
pancreatic beta cell line. Proc Natl Acad Sci USA 1993;
90:5781-5. [93296223]
6. Chao MV, Hempstead BL. p75 and Trk: a two-
receptor system. Trends Neurosci 1995; 18:321-6.
7. Singh J, Adeghate E, Salido GM, Pariente JA, Yago
MD, Juma LO. Interaction of islet hormones with
cholecystokinin octapeptide-evoked secretory responses
in the isolated pancreas of normal and diabetic rats. Exp
Physiol 1999; 84:299-318.
8. Rausa FM, Ye H, Lim L, Duncan SA, Costa RH. In
situ hybridization with 33P-labeled RNA probes for
determination of cellular expression patterns of liver
transcription factors in mouse embryos. Methods 1998;
16:29-41. [98450013]
9. Tazi A, Czernichow P, Scharfmann R. Similarities
and discrepancies in the signaling pathway for nerve
growth factor in an insulin producing cell line and a
neural crest-derived cell line. J Neuroendocrinol 1995;
7:29-36.
10. Hellerstrom CH, Lewis NJ, Borg H, Johnson R,
Freinkel N. Method for large-scale isolation of pancreatic
islets by tissue culture of fetal rat pancreas. Diabetes
1979; 28:769-76.
11. Knaack D, Fiore DM, Surana M, Leiser M, Laurance
M, Fusco-DeMane D, et al. Clonal insulinoma cell line
that stably maintains correct glucose responsiveness.
Diabetes 1994; 43:1413-7.
12. Clark SA, Burnham BL, Chick WL. Modulation of
glucose-induced insulin secretion from a rat clonal beta-
cell line. Endocrinology 1990; 127:2779-88.
13. Chomczynski P, Sacchi N. Single-step method of
RNA isolation by acid guanidinium thiocyanate-phenol-
chloroform extraction. Anal Biochem 1987; 162:156-9.
14. Conover JC, Yancopoulos GD. Neurotrophin
regulation of the developing nervous system: analyses of
knockout mice. Rev Neurosci 1997; 8:13-27.
15. Timmusk T, Belluardo N, Metsis M, Persson H.
Widespread and developmentally regulated expression of
neurotrophin-4 mRNA in rat brain and peripheral tissues.
Eur J Neurosci 1993; 5:605-13.
16. Torcia M, Bracci-Laudiero L, Lucibello M, Nencioni
L, Labardi D, Rubartelli A, et al. Nerve growth factor is
an autocrine survival factor for memory B lymphocytes.
Cell 1996; 85:345-56.
17. Cho HJ, Kim SY, Park MJ, Kim DS, Kim JK, Chu
MY. Expression of mRNA for brain-derived
neurotrophic factor in the dorsal root ganglion following
peripheral inflammation. Brain Res 1997; 749:358-62.
[97439667]
18. Zhou XF, Chie ET, Deng YS, Rush RA. Rat mature
sympathetic neurones derive neurotrophin 3 from
peripheral effector tissues. Eur J Neurosci 1997; 9:2753-
64.
19. Zhang SH, Zhou XF, Deng YS, Rush RA.
Measurement of neurotrophin 4/5 in rat tissues by a
sensitive immunoassay. J Neurosci Methods 1999;
89:69-74.
20. Miralles F, Czernichow P, Scharfmann R. Pancreatic
acinar AR42J cells express functional nerve growth
factor receptors. J Endocrinol 1999; 160:433-42.
[99180663]
21. De Vicente JC, Garcia-Suarez O, Esteban I,
Santamaria J, Vega JA. Immunohistochemical
localization of neurotrophins and neurotrophin receptors
in human and mouse salivary glands. Anat Anz 1998;
180:157-63.
22. Tazi A, Le Bras S, Lamghitnia HO, Vincent JD,
Czernichow P, Scharfmann R. Neurotrophin-3 increases
intracellular calcium in a rat insulin-secreting cell line

Page 7
JOP. J. Pancreas (Online) 2001; 2(3):105-111.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 3 – May 2001
111
through its action on a functional TrkC receptor. J Biol
Chem 1996; 271:10154-60. [96215307]
23. Scharfmann R, Atouf F, Tazi A, Czernichow P.
Growth hormone and prolactin regulate the expression of
nerve growth factor receptors in INS-1 cells.
Endocrinology 1994; 134:2321-8.
24. Scharfmann R, Tazi A, Polak M, Kanaka C,
Czernichow P. Expression of functional nerve growth
factor receptors in pancreatic beta-cell lines and fetal rat
islets in primary culture. Diabetes 1993; 42:1829-36.
25. Price P, Baxter AG, Allcock RN, Papadimitriou JM.
Factors influencing the effects of murine
cytomegalovirus on the pancreas. Eur J Clin Invest 1998;
28:546-53. [98394098]
26. Terauchi Y, Tamemoto K, Kadowaki T. New
diabetes mellitus models: gene targeting. Exp Anim
1998; 47(Suppl):110-4.
27. Hugl SR, White MF, Rhodes CJ. Insulin-like growth
factor I (IGF-I)-stimulated pancreatic beta-cell growth is
glucose-dependent. Synergistic activation of insulin
receptor substrate-mediated signal transduction pathways
by glucose and IGF-I in INS-1 cells. J Biol Chem 1998;
273:17771-9. [98316350]
28. Bernard C, Berthault MF, Saulnier C, Ktorza A.
Neogenesis vs. apoptosis as main components of
pancreatic beta cell mass changes in glucose-infused
normal and mildly diabetic adult rats. FASEB J 1999;
13:1195-205. [99315535]
29. Pick A, Clark J, Kubstrup C, Levisetti M, Pugh W,
Bonner-Weir S, Polonsky KS. Role of apoptosis in
failure of beta-cell mass compensation for insulin
resistance and beta-cell defects in the male Zucker
diabetic fatty rat. Diabetes 1998; 47:358-

There are no products listed under this category.