Association between ACE Gene Polymorphism

Vijay Viswanathan1, Yanqing Zhu2, Karthik Bala2, Stephen Dunn2, Chamukuttan Snehalatha1,
Ambady Ramachandran1, Muthu Jayaraman1, Kumar Sharma2
1Diabetes Research Centre. Madras, India. 2Division of Nephrology, Dorrance Hamilton Research
Laboratories, Department of Medicine, Thomas Jefferson University. Philadelphia, USA
ABSTRACT
Objective To study the association of ACE
gene polymorphism and diabetic nephropathy
in South Indian subjects.
Setting Outpatient clinic of a specialized
hospital.
Patients The study included 109 South Indian
type 2 diabetic patients (72 males and 37
females; age 56.7±9.0 years, mean±SD). The
patients were subdivided into two groups:
nephropathic (n=86) and normoalbuminuric
patients (n=23).
Interventions Genomic DNA was isolated
from the peripheral blood leukocytes. To
determine the ACE genotype, genomic DNA
was amplified by PCR initially using a flanking
primer pair and, subsequently when necessary,
with a primer pair that recognizes the insertion
specific sequence for confirmation of the
specificity of the amplification reactions.
Main outcome measures ACE genotype
distribution in the two study groups.
Results In the nephropathic patients, ID and
DD genotypes were present in 52.3% and
27.9% of the patients, respectively as compared
to 34.8% and 21.7% respectively in those with
normoalbuminuria. The D allele was present in
80.2% of the nephropathic patients and 56.5%
of the normoalbuminuric patients (χ2=4.28,
P=0.039; odds ratio 3.12). Therefore, the higher
percentage of II genotype in the
normoalbuminuric group was 43.5% as
compared to the 19.8% in nephropathic
patients.
Conclusions This study showed a positive
association between the D allele (ID and DD
genotype) of the ACE polymorphism and
diabetic proteinuria in South Indian type 2
diabetic patients. Our findings are in keeping
with several earlier studies showing a strong
association of the D allele of the ACE gene
with diabetic nephropathy.
INTRODUCTION
South Asian type 2 diabetic patients have been
shown to have a higher prevalence of
nephropathy when compared to Europeans [1,
2].
ACE polymorphism appears to have a
significant impact on the progression of
diabetic nephropathy [3]. Several Japanese
studies have found the D allele to be an
independent risk factor for diabetic
nephropathy [4]. It is important to look for the
gene association in the Asian Indian population,
in view of the high prevalence of diabetic
nephropathy and to see whether the association
differs from other populations. To our
knowledge, there have been no studies on ACE

Page 2
JOP. J. Pancreas (Online) 2001; 2(2):83-87.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 2. March 2001
84
gene polymorphism in the native Indian
population.
METHODS
Patients
The study was carried out in 109 South Indian
type 2 diabetic patients (72 males and 37
females; age 56.7±9.0 years, mean±SD).
Inclusion criteria were: patient age greater than
or equal to 30 years, duration of type 2 diabetes
greater than or equal to 5 years. Patients not on
oral hypoglycemic agents and/or with
congestive cardiac failure were excluded from
the study.
Eighty-six of these 109 patients were
consecutive cases with nephropathy referred as
outpatients at the hospital during a 7-month
period. These patients were selected on the
basis of:
• presence of persistent proteinuria greater
than or equal to 500 mg/dL;
• presence of hypertension;
• presence of diabetic retinopathy;
• normal urine microscopy.
In addition, 23 patients with normoalbuminuria,
normal urine microscopy and absence of both
hypertension and retinopathy were studied.
Normoalbuminuria was defined on the basis of
an albumin excretion rate less than or equal to
30 µg/mg creatinine in early morning urine
samples using the immunoturbidimetry method
for albumin. These patients were selected from
the outpatients treated in the hospital in the
same time period.
Data on the duration of the diabetes, blood
pressure, prevalence of hypertension,
glycosylated hemoglobin (HbA1) and body
mass index (BMI, Kg/m2) were recorded for
each patient.
DNA Isolation and Determination of ACE
Genotype
Genomic DNA was isolated from peripheral
blood leukocytes according to published
protocols for extracting DNA from human
nucleated cells [5]. To determine the ACE
genotype, genomic DNA was amplified by
PCR [6] initially using a flanking primer pair
and subsequently when necessary, with a
primer pair that recognizes the insertion
specific sequences for confirmation of the
specificity of the amplification reactions.
The flanking primer pair used was
5’CTGGAGACCACTCCCATCCTTTCT3’ and
5’GATGTGGCCATCACATTCGTCACGAT3’.
Amplification with this primer pair results in
490 bp and 190 bp amplification products
corresponding to the I and D alleles,
respectively. PCR amplification used 25 µL
reactions (0.5 µg genomic DNA, 200 pmol of
each primer, 0.5 mM each of deoxy-ATP, GTP,
CTP, thymidine 5-triphosphate (TTP), 3 mM
MgCl2, 1 unit of Taq DNA polymerase (Perkin-
Elmer, Norwalk, CT, USA), 0.001% gelatin
and 10 mM Tris-HCl, pH 8.3) with 10 min.
denaturation at 94 oC, followed by 30 cycles of
one min. at 94 oC, one min. at 58 oC (annealing)
and two min. at 72 oC (extension) in a thermal
cycler. PCR products were detected on a 2%
agarose-gel containing ethidium bromide.
Mistyping of ID heterozygotes as D
homozygotes may occur due to the preferential
amplification of the D allele and inefficiency in
the amplification of the I allele [7]. To increase
the specificity of DD genotyping, PCR
amplifications were also performed with an
insertion
specific
primer
pair
(5’TGGGACCACAGCGCCCGCCACTAC3’
and 5’TCGCCAGCCCTCCCATGCCCATAA3’)
in all samples that were found to be DD after
amplification with the flanking primers.
Briefly, insertion-specific amplification was
performed using 25 µL reactions (0.5 µg
genomic DNA, 200 pmol of each primer, 0.5
mM each of deoxy-ATP, GTP, CTP, TTP, 3
mM MgCl2, 0.5 units of Taq DNA polymerase,
0.001% gelatin and 10 mM Tris-HCl, pH 8.3)
with one min. denaturation at 94 oC, followed
by 30 cycles of 30 sec. at 94 oC, 45 sec at 67 oC
(annealing), and two min. at 72 oC (extension).
Under these conditions, only the I allele
produced a 335 bp amplicon. The 335 bp

Page 3
JOP. J. Pancreas (Online) 2001; 2(2):83-87.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 2. March 2001
85
fragment was identified on 2% agarose-gel
containing ethidium bromide. The reaction
yields no products in samples of DD genotype.
ETHICS
The study was approved by the ethical
committee of the Diabetes Research Centre of
Madras. Informed oral consent was obtained
from each patient.
STATISTICS
Data are reported as mean ± standard deviation
(SD). Statistical comparisons between group
means were done by the unpaired Student t-test,
while proportions were compared by means of
the Yates’ corrected chi-squared test (χ2). The
odds ratio (OR), together with the 95%
confidence interval (CI), comparing the allelic
distributions in the two study groups were also
calculated. Two-tailed P values less than 0.05
were considered significant. The SPSS/PC+
4.01 package was used to perform statistical
analyses.
RESULTS
As shown in Table 1, the two study groups
were well-matched for gender, age, body mass
index (BMI), duration of both diabetes and
hypertension, and HbA1 values. Nephropathic
patients had significantly higher systolic and
diastolic blood pressure values.
Table 2 shows the ACE genotype distribution
in nephropathic and normoalbuminuric patients.
Among the total patients, 27 (24.8%) patients
had the II genotype, while the ID genotype was
present in 53 patients (48.6%) and the DD
genotype in 29 patients (26.6%). In
nephropathic patients, the ID and DD
genotypes were present in 52.3% and 27.9% of
patients, respectively, as compared to 34.8%
and 21.7% in normoalbuminuric patients. Total
D allele was present with a significantly higher
prevalence (χ2=4.28, P=0.039) in nephropathic
Table 1. Clinical details of 109 South Indian type 2 diabetic patients.
Nephropathic
patients
(No. 86)
Normoalbuminuric
patients
(No. 23)
Statistics
P value
Sex: males / females
57 (66.3%) / 29 (33.7%) 15 (65.2%) / 8 (34.8%)
χ2=0.00
1.000
Age (years)
56.7+8.9
56.7+9.3
t=0.00
1.000
BMI (Kg/m2)
25.9+4.2
25.7+3.5
t=0.21
0.834
Duration of diabetes (years)
13.4+6.9
13.2+5.1
t=0.13
0.897
Duration of hypertension (years)
6.1+3.5
5.7+3.8
t=0.48
0.634
Systolic blood pressure (mmHg)
146.6+18.6
132.0+13.6
t=3.52
<0.001
Diastolic blood pressure (mmHg)
85.1+8.5
80.9+10.0
t=2.03
0.045
HbA1 (%)
9.8+1.1
9.9+1.0
t=-0.40
0.689
Table 2. Distribution of ACE genotype in 109 South Indian type 2 diabetic patients.
Nephropathic patients
Normoalbuminuric patients
ACE genotype
No. of cases
(% vs. total D)
% vs. overall
cases
No. of cases
(% vs. total D)
% vs. overall
cases
ID
45 (65.2%b)
52.3%
8 (61.5%b)
34.8%
DD
24 (34.8%b)
27.9%
5 (38.5%b)
21.7%
Total D alleles (ID+DD)
69
80.2%a
13
56.5%a
II
17
19.8%a
10
43.5%a
Overall No. of cases
86
23
χ= 4.28; P=0.039. Total D and II allele distributions (nephropathy vs. normoalbuminuria)
χ= 0.00; P=1.000. ID and DD distributions within total D alleles (nephropathy vs. normoalbuminuria)

Page 4
JOP. J. Pancreas (Online) 2001; 2(2):83-87.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 2. March 2001
86
patients (80.2%) than in normoalbuminuric
patients (56.5%); therefore, the percentage of II
genotype was higher in normoalbuminuric
patients (43.5%) as compared to the
nephropathic patients (19.8%). According to
these prevalence values, the odds ratio (OR)
related to the association of the D allele with
nephropathy was 3.12 (95% CI: 1.17-8.32). No
significant differences between nephropathic
and normoalbuminuric patients were observed
as far as the distribution of the ID and DD
alleles within the total D class were concerned
(χ2=0.00, P=1.000). Taking into account
nephropathic patients only, the severity of
proteinuria, as well as the blood levels of urea
and creatinine, were not significantly related to
the different genotypes (considering II, ID, and
DD alleles, respectively: proteinuria:
1,940+1,401, 2,017+1,632, and 1,965+1,603
mg/dL; urea 43+31, 38+14, and 38+17 mg/dL;
creatinine 1.3+1.0, 1.1+0.6, and 1.1+0.6
mg/dL).
DISCUSSION
This study demonstrated a positive association
between the D allele (ID and DD genotype) of
the ACE polymorphism and diabetic
nephropathy in South Indian type 2 diabetic
patients. Several Japanese studies had also
found the D allele to be an independent risk
factor for diabetic nephropathy in type 2
diabetic patients [4, 6, 8]. The odds ratio noted
in our study for the association of D allele with
nephropathy (OR=3.12) was comparable to the
report of Ohno et al. [8] (OR=2.6) and Yoshida
et al. [6] (OR=4.6) in similar analyses. Jeffers
studied 509 type 2 Caucasian diabetic patients
and found the DD genotype to be an
independent risk factor for diabetic
nephropathy with an OR equal to 2.8 [9].
A meta analysis showed that patients who were
homozygous for the deletion allele (DD
genotype) had a rapid decline in renal function
and the D allele also appeared to be
significantly associated with diabetic
nephropathy [10]. We did not observe any
association between the D allele and severity of
nephropathy. This is probably related to the
small numbers in each allelic group. Kennon et
al. also, in their review of the literature, found a
significant association between the DD
genotype and diabetic and non-diabetic renal
disease [3]. The French and Belgian
GENEDIAB study demonstrated that the D
allele was associated with both an increased
incidence and severity of diabetic nephropathy
in a large group of type 1 diabetic patients [11].
We have not studied the distribution of ACE
gene polymorphism in the general population.
In the diabetic nephropathy group, there was an
elevated association with the D allele. This was
in keeping with the observations in several
populations. Follow-up studies of the patients
are being carried out to study the relationship of
the genotypes with the severity and the rate of
decline of kidney function.
Received October 7th, 2000 – Accepted October
30th, 2000
Key words Diabetes Mellitus, Non-Insulin-
Dependent; Diabetic Nephropathies; India;
Peptidyl-Dipeptidase
A;
Polymorphism
(Genetics)
Abbreviations TTP: thymidine 5-triphosphate
Acknowledgements We thank Shina K. for
help in the analysis of the data and Felinta M.
for secretarial assistance
Correspondence
Vijay Viswanathan
Diabetes Research Centre
No. 4, Main Road, Royapuram
Madras - 600 013
India
 

Page 5
JOP. J. Pancreas (Online) 2001; 2(2):83-87.
JOP. Journal of the Pancreas – http://www.joplink.net – Vol. 2, No. 2. March 2001
87
References
1. Mather HM, Chaturvedi N, Kehely AM. Comparison
of prevalence and risk factors for microalbuminuria in
South Asians and Europeans with type 2 diabetes
mellitus. Diabet Med 1998; 15:672-7. [98367848]
2. Burden AC, Mc Nally PG, Fee Gally J, Walls J.
Increased incidence of end stage renal failure secondary
to diabetes mellitus in Asian ethnic groups in the United
Kingdom. Diabet Med 1992; 9:641-5. [92380005]
3. Kennon B, Petrie JR, Small M, Connell JMC.
Angiotensin-converting enzyme gene and diabetes
mellitus. Diabet Med 1999; 60:448-58. [99318275]
4. Doi Y, Yoshzimi H, Yoshinari M, Lion K,
Yamamoto M, Ichikawa K, et al. Association between a
polymorphism in the angiotensin-converting enzyme
gene and microvascular complication in Japanese
patients with NIDDM. Diabetologia 1996; 39:97-102.
5. Miller SA, Dykes DD, Polesky HF. A simple salting
out procedure for extracting DNA from human nucleated
cells. Nucleic Acids Res 1988; 16:1215.
6. Yoshida H, Kuriyama S, Atsumi Y, Tomonari H,
Mitarai T, Hamaguchi A, et al. Angiotensin I converting
enzyme gene polymorphism in non-insulin dependent
diabetes mellitus. Kidney Int 1996; 50:657-64.
[96437652]
7. Shanmugam V, Sell KW, Saha BK. Mistyping of
ACE heterozygotes. PCR Methods Appl 1993; 3:120-21.
8. Ohno T, Kawazu S, Tomono S. Association analyses
of the polymorphisms of angiotensin-converting enzyme
and angiotensinogen genes with diabetic nephropathy in
Japanese non-insulin-dependent diabetics. Metabolism
1996; 45:218-22. [96174689]
9. Jeffers BW, Estacio RO, Raynolds MV, Schrier RW.
Angiotensin-converting enzyme gene polymorphism in
non-insulin dependent diabetes mellitus and its
relationship with diabetic nephropathy. Kidney Int 1997;
52:473-7. [97409643]
10. Fujisawa T, Ikegami H, Kawaguchi Y, Hamada Y,
Ueda H, Shintani M, et al. Meta-analysis of association
of insertion/deletion polymorphism of angiotensin I
converting enzyme gene with diabetic nephropathy and
retinopathy. Diabetologia 1998; 41:47-53. [98158394]
11. Marre M, Jeunemaitre X, Gallois Y, Rodier M,
Chatellier G, Sert C, et al. Contribution of genetic
polymorphism in the renin-angiotensin system to the
development of renal complications in insulin-dependent
diabetes: Genetique de la Nephropathie Diabetique
(GENEDIAB) study group. J Clin Invest 1997; 99:1585-
95. [97248271]

There are no products listed under this category.