Cytokine Gene Polymorphisms

Kevin Sargen
1,2
, Andrew G. Demaine
1
, Andrew N. Kingsnorth
2
1Departments of Molecular Medicine and 2Surgery Plymouth Postgraduate Medical School,
Derriford Hospital. Plymouth, United Kingdom.
ABSTRACT
Context Pro-inflammatory and regulatory
cytokines play a key role in the pathogenesis
of acute pancreatitis. Genetic loci encoding
cytokines have been shown to be
polymorphic, in some cases influencing
protein expression.
Objective To investigate if TNF and IL-10
gene loci are associated with the occurrence
or severity of acute pancreatitis.
Setting Acute surgical unit within large
district hospital serving a population of
500,000.
Methods Three TNF microsatellite loci
(TNFa, TNFb, TNFc), the TNF-308
polymorphism, the IL-10.G microsatellite
locus, and 3 bi-allelic polymorphisms in the
IL-10 5’ region were typed using PCR in
135 acute pancreatitis patients and ethnically
matched normal controls (n=107). Aetiology
of disease was determined and patients
grouped according to disease severity by
assigning an organ failure score or
classification according to the Atlanta
system.
Main outcome measures Allelic frequency
of polymorphic loci in patients with different
aetiology and disease course in acute
pancreatitis.
Results No difference was noted in allelic
frequency of any of the cytokine gene loci
between groups stratified according to
disease severity. When aetiology was studied
again there was no significant difference in
allelic frequency.
Conclusions
The
cytokine
gene
polymorphisms studied play no part in
determination of disease severity or
susceptibility to acute pancreatitis.
INTRODUCTION
The clinical course of acute pancreatitis is
often mild with only minimal associated
organ dysfunction, but a significant
proportion of patients develop severe
pancreatitis which is associated with organ
failure, systemic complications, local
inflammatory and infective manifestations
and, in up to 10% of cases, death.
Pro-inflammatory and regulatory cytokines
play a fundamental role in the local and
systemic inflammatory response in the initial
stages of disease and in the development of
severe acute pancreatitis [1, 2]. Tumour
necrosis factor-α (TNF-α) and TNF-β are
potent mediators of the immune response

Page 2
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
25
and are central to the initiation of the
cytokine network, causing other pro-
inflammatory cytokines such as interleukins-
6 and 8 (IL-6, IL-8) to be produced [3, 4].
TNF expression in the pancreas is increased
by the onset of experimental pancreatitis [5-
7], and antagonism of TNF reduces the
severity of local pancreatic inflammation [5,
8]. Levels of soluble TNF receptors,
indicators of TNF activity, have been found
to be increased in patients with severe
disease [9], and TNF blockade has been
shown to reduce mortality and ameliorate
markers of severe systemic disease in
experimental acute pancreatitis [10].
Interleukin–10 (IL-10) is a cytokine with
regulatory, anti-inflammatory effects. For
example, macrophage secretion of TNF and
other pro-inflammatory cytokines are
profoundly suppressed by IL-10 [11]. IL-10
administration is known to attenuate local
pancreatic inflammation in experimental
models of acute pancreatitis [12, 13], and
also reduces mortality rates in experimental
animals [14]. In patients with acute
pancreatitis, IL-10 serum levels are reduced
in severe as opposed to mild disease [15].
The TNFα and β loci are located within the
major histocompatibility complex (MHC),
tandemly arranged over 7 kilobases (Kb),
within the class III region. There are a
number of polymorphic sites within the TNF
loci, including an AC/GT repeat (TNFa),
two closely linked TC/GA repeats (TNFb
and TNFc) [16], and a bi-allelic
polymorphism consisting of a G to A
substitution at position -308 in the TNF-α
promoter region [17]. The TNFa and TNFb
microsatellites are 3.5 Kb upstream of the
TNF-β locus, TNF-c being located in the
first intron.
Whilst there is no conclusive evidence
regarding the functional role of the -308
polymorphism, alleles a2 and c2 of the TNFa
and TNFc microsatellites have been
associated with higher TNF production [18],
as have certain TNF haplotypes [19]. Certain
TNF alleles and haplotypes have been found
to be associated with inflammatory diseases
such as Crohn’s disease [20].
The gene encoding IL-10 has been mapped
to chromosome 1 [21]. The IL-10 promoter
contains numerous and varied transcription
factor binding sites [22], and two regions
within it, -1100 to –900, and -800 to –300,
have been identified as having effects upon
gene transcription [23]. Close to or within
this region are 4 polymorphic sites, 3 single
base transitions at –1117 (G to A
substitution), -854 (C to T substitution), and
–627 (C to A substitution). There is also a
(CA)n
repeat, the IL10.G microsatellite,
located between positions -1193 and –1151
[24]. It is postulated that polymorphisms in
this region may be functional through their
associated alteration of an important
transcription factor binding site. Indeed, the
slightly more common allele of the –1117
polymorphism (-1117.G) has been shown to
produce higher in vitro production of IL-10
by stimulated monocytes [25].
In this study we have evaluated the
association of the TNF and IL-10 genes with
acute pancreatitis and resultant disease
severity.
PATIENTS AND METHODS
Patients
One hundred and 35 Caucasian patients
admitted with a diagnosis of acute
pancreatitis were identified shortly after
admission to hospital. The criteria for
diagnosis of acute pancreatitis were: a
clinical history consistent with the disease,
appropriate radiological evidence, and a
serum amylase level greater than 660 U/L
(Hitachi 911, Hitachi Corporation, Japan;
normal range <220 U/L). The progress of
individuals with regard to development of
complications was monitored during their
disease episode, enabling patients to be
classified as having mild disease or severe
local or systemic disease according to criteria
defined by the Atlanta convention [26].
Maximal organ failure scores (OFS) [27]

Page 3
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
26
were also calculated to provide another
means of patient stratification.
Aetiology of acute pancreatitis was classified
as being due to gallstones in the presence of
appropriate radiological or endoscopic
retrograde
cholangiopancreatography
(ERCP) findings (n=77), alcoholic if subjects
admitted on questioning to being consistent
heavy consumers of alcohol (n=21), or
idiopathic if no other identifiable cause could
be discovered (n=37). Consistent heavy
consumption of alcohol was defined as daily
consumption of greater than 80 g of alcohol
per day over a time period exceeding six
months. No subjects who had acute
pancreatitis secondary to excessive ‘binge’
consumption of alcohol were encountered
during recruitment for this study. Any history
of alcohol consumption recorded in medical
notes was confirmed by interviews with
individual patients.
Patients who had clinical, radiological, or
ERCP evidence suggestive of a diagnosis of
chronic pancreatitis were excluded. CT or
ERCP was performed if there was a clinical
suspicion of chronic pancreatitis in those
patients with alcohol induced disease. In 15
of 21 patients (71%) classified as having
acute alcohol-induced acute pancreatitis CT
or ERCP was performed. The other 28.6%
(6 of 21) who had no clinical suspicion of
chronic pancreatitis had an adequate
ultrasound scan (pancreas clearly visualised),
with no evidence of chronic pancreatitis in
this imaging modality.
Controls
One hundred and seven Caucasoid cord
blood samples following a normal healthy
obstetric delivery were used to obtain control
allele and genotype frequencies in the TNF
assays, but up to 136 controls were used in
the IL-10 assays.
DNA Preparation
High molecular weight DNA was prepared
from peripheral venous blood using the
Nucleon II DNA extraction kit (Scotlab,
Lanarkshire, UK).
TNF Microsatellite Typing
The three microsatellite loci, TNFa, TNFb,
and TNFc were amplified by the polymerase
chain reaction (PCR) as a one-step
procedure using oligonucleotide amplimers
synthesised (Pharmacia Biotech, Sweden)
from previously described sequences [16,
28]. 100-500 ng of genomic DNA was added
to a final reaction volume of 20 µl with 0.5
µM of each amplimer pair (reverse amplimer
5’-end-labelled with 50,000 cpm of 32P), 10
mM Tris-HCL (pH 9.0), 50 mM KCl, 2.5
mM MgCl2, 0.1% Triton X-100, 300 µM of
each dNTP, and 0.8 units of Taq DNA
polymerase (HT Biotechnology, Cambridge,
UK). PCR for TNFa and TNFb were
performed in a Cyclogene thermocycler
(Techne, Cambridge, UK) under the
following conditions: 95 °C for 3 minutes,
then 30 cycles of 95 °C for 1 minute, 62 °C
for 1 minute, and 68 °C for 1 minute
followed by a 3 minute extension at 68 °C.
The TNFc microsatellite was amplified in an
identical way but employing an annealing
temperature of 58 °C. Amplification
products (6 µl) mixed with 3 µL of Stop
solution containing Formamide (Amersham
Life Science, Buckinghamshire, UK) were
then separated on a 6% polyacrylamide gel
with 8 M urea at 1700 V for 2.5 hours
(TNFa and TNFc), or 3 hours (TNFb). After
drying the gels were exposed to Kodak
XLS5 X-ray film (Scientific Imaging
Systems, Cambridge, UK) with intensifying
screens at –70 °C for 18 hours.
TNF -308 Typing
Amplification of an 836 base pair (bp)
fragment of the TNF promoter region was
performed in two PCR-SSP reactions. These
employed a common forward amplimer:
5’-CTGCATCCCCGTCTTTCTCC-3’
and one of two reverse amplimers with a 3’
mismatch corresponding to a G or an A at
position -308:

Page 4
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
27
5’-ATAGGTTTTGAGGGGCATCG-3’
5’-ATAGGTTTTGAGGGGCATCA-3’
Amplimers for a 256 bp control amplicon
from exon 15 of the adenomatous polyposis
coli gene was included in the same
reaction.100-500 ng of genomic DNA was
added to a final reaction volume of 20 µl
with 0.5 µM of each amplimer pair, 10 mM
Tris-HCL (pH 9.0), 50 mM KCl, 2.5 mM
MgCl2, 0.1% Triton X-100, 300 µM of each
dNTP, and 0.8 units of Taq DNA
polymerase (HT Biotechnology, Cambridge,
UK). The assay was performed in a PTC-200
Thermal Cycler (MJ Research, Essex, UK)
under the following cycling conditions: 96
°C for 3 minutes, then 30 cycles of 96 °C for
45 seconds, 55 °C for 80 seconds, and 72 °C
for 2 minutes followed by a 3 minute
extension at 72 °C.
The entire reaction volume plus 5 µl of
Orange G track dye were loaded into a 1%
agarose gel containing ethidium bromide.
Gels were electrophoresed for 20 minutes at
200 V. The gels were then photographed
under UV light (320 nm) and scored for the
presence or absence of an allele specific band
providing a PCR control band was present.
IL-10 –1117, -854, and –627 Typing
Amplification of an 587 bp region containing
the three polymorphisms at positions –1117,
-854, and –627 was performed in a
Cyclogene
thermocycler
(Techne,
Cambridge, UK) in 20 µl volumes using the
forward amplimer 5’-ATCCAAGCAAC
ACTACTAA-3’ and reverse amplimer 5’-
TAAATATCCTCAAAGTCCC-3’.
The
reaction mixture contained 0.5 µM of each
amplimer pair, 10 mM Tris-HCL (pH 9.0),
50 mM KCl, 2.5 mM MgCl2, 0.1% Triton X-
100, 300 µM of each dNTP, and 0.8 units of
Taq DNA polymerase (HT Biotechnology,
Cambridge, UK). PCR product was blotted
onto Hybond N+ nylon transfer membrane
(Amersham, Bucks, UK).
Two 5’-end labelled digoxigenin probes were
used to detect each polymorphism. For the -
1082
locus,
the
probes
were
TAAGGCTTCTTTGGGAGG
and
TAAGGCTTCTTTGGGAAG (wash T° =
60 °C). For the -819 locus the probes were
CAGGTGATGTAACATCTCTGTCG and
GCACAGAGATATTACATCACCTGT
(wash T° = 70 °C). For the -592 locus the
probes used were TGTGACCCCGCCTGCC
and CTGTGACCCCGCCTGAC (wash T° =
62 °C). Probes were hybridised at 42 °C and
washed in 3.2 M tetra-methyl-ammonium
chloride (TMAC) solution. Anti-digoxigenin
antibody was used in conjunction with a
chemoluminescent detection system to detect
bound probe.
IL-10.G Microsatellite Typing
Amplification of a region containing the
microsatellite was performed using the
forward
amplimer
5’-
TCCTTCCCCAGGTAGAGCAACACTCC-
3’, and reverse amplimer 5’-
TCCCAAAGAAGCCT TAGT AGTGTTG-
3’. The former was 5’-end labelled with [γ
32P] ATP. The reaction mixture contained
0.5 µM of each amplimer pair, 10 mM Tris-
HCL (pH 9.0), 50 mM KCl, 2.5 mM MgCl2,
0.1% Triton X-100, 300 µM of each dNTP,
and 0.8 units of Taq DNA polymerase (HT
Biotechnology, Cambridge, UK).
Amplification products (6µl) mixed with 3 µl
of Stop solution containing Formamide
(Amersham Life Science, Buckinghamshire,
UK) were then separated on a 6%
polyacrylamide gel with 8 M urea at 1700 V
for 2.5 hours, and alleles revealed with
autoradiography.
ETHICS
Local ethical committee approval had been
obtained, confirming the study protocol
conformed to the guidelines of the
Declaration of Helsinki (1975, revised 1983)
and patients gave informed consent.

Page 5
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
28
STATISTICAL ANALYSIS
Patient groups were compared with respect
to age, which is expressed as median and
range. Distribution of age was tested for
normality using Statgraphics software
(Statistical Graphics Corp. USA. 1996).
Distribution in subject groups was tested for
normality using the χ2
goodness-of-fit
statistic, the Shapiro-Wilkes W statistic, the
z-score for skewness, and the z-score for
kurtosis. As no group fitted normal
distribution this tends to invalidate
comparison of means and standard deviations
using conventional testing. Therefore, a non-
parametric test (Kolmogorov-Smirnov) was
used to compare whether there is a
statistically significant difference in
distribution of age between study groups.
Comparisons of allelic and haplotype
frequencies between patient subgroups and
controls were made in 2 x 2 contingency
tables using the χmethod. Corrections were
made if necessary for small sample numbers
using Fisher’s exact test. P values were
corrected for multiple comparisons made
using the Bonferroni inequality method.
Corrected p values of less than 0.05 were
considered statistically significant.
RESULTS
Patient Groups
Of the 135 patients in this study, 97 had mild
disease as defined by the Atlanta criteria
[26]. Of the 38 patients with severe disease,
30 had systemic complications defined by at
least one organ dysfunction, 21 patients had
a local pancreatic collection (fluid, necrosis,
or pseudocyst), of whom only 8 did not have
concurrent systemic complications. 18
patients had organ failure scores of 3 or
more, with the respiratory system accounting
for at least 3 of the score [27].
In 21 patients the episode of acute
pancreatitis was caused by alcohol (80
g/day), in 77 the cause was cholelithiasis, and
in 37 patients no cause could be identified
(classified as idiopathic).
Age and sex characteristics of controls and
patient subgroups are displayed in Table 1.
Testing with a non-parametric test revealed
that distribution of age was younger in
patients with mild acute pancreatitis
compared to those with severe disease
(p=0.007, Kolmogorov-Smirnov test), but
not those with an OFS3 (p=0.11,
Kolmogorov-Smirnov test). The group with
alcohol induced acute pancreatitis were
significantly younger than those with another
aetiology (p<0.001, Kolmogorov-Smirnov
test).
Sex distribution was comparable between all
groups, apart from the group with alcoholic
pancreatitis, where all but one subject was
male (normal controls vs. alcoholic
pancreatitis, χ2=19.2, p<0.001, Idiopathic vs.
alcoholic pancreatitis, χ2=11.7, p<0.001,
Gallstone vs. alcoholic pancreatitis, χ2=25.0,
p<0.001).
TNF Microsatellite Allele Frequencies
Allelic frequencies were measured in 100%
of patients. We observed 13 of 14 known
alleles of TNFa in the population studied. Six
of the seven known alleles of TNFb were
found in our patient and control groups.
TNFc is biallelic. Table 2 shows the allelic
frequencies at the three loci in control and
subject groups.
When patients were grouped according to
aetiology there was a trend towards reduced
frequency of the TNFa2 allele in those
patients with alcoholic acute pancreatitis
compared to controls (χ2=7.24, p=0.098), or
compared to those with pancreatitis of other
aetiology (χ2=4.51, p=0.374).
There are no statistically significant
differences in the allelic frequencies of the
TNF-a, TNF-b, or TNF-c loci when
comparing all acute pancreatitis patients with
controls or when patients grouped according
to disease course (mild vs. severe, mild vs.
OFS3) were compared.

Page 6
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
29
Table 1 Age and sex characteristics of controls and patient subgroups
Normal
controls
(n=1071)
AP
Patients
(n=135)
Mild
AP*
(n=97)
Severe
AP*
(n=38)
OFS3
(n=18)
Alcoholic
AP
(n=21)
Idiopathic
AP
(n=37)
Gallstone
AP
(n=77)
Age
(years)
Median
n/a 2
58
56 a
65.5 a
65.5
43 b c
61 b
60 c
Range
n/a 2
21-86
21-86
26-78
26-78
28-64
23-84
21-86
Sex
Males
46 (43%) d
66 (49%) 49 (51%) 17 (45%) 10 (56%) 20 (95%)
def
19 (51%) e
26 (34%)f
Females
61 (57%) 69 (51%) 48 (49%) 21 (55%) 8 (44%)
1 (5%)
18 (49%)
51 (66%)
Patient groups are described in Material and Methods
AP: Acute pancreatitis
OFS: Organ failure score (calculated according to method previously described[27])
n represents the number of subjects in each group
* Mild and severe disease severity groups are according to the Atlanta convention classification [26]
In the IL-0 assays up to 136 controls were used. The relative sex frequency was not significantly different from
the group of 107 individuals.
Age not applicable to controls as these were new born infants
Significant differences in age distribution in following groups:
Severe Mild, p=0.007
Idiopathic Alcoholic pancreatitis, p=0.003
Gallstones Alcoholic pancreatitis, p<0.001
However, no significant difference in age distribution between mild group and OFS ≥ 3, p=0.11
Significant differences in sex distribution between:
Normal controls and Alcoholic pancreatitis, χ2=19.2, p<0.001
Idiopathic and Alcoholic pancreatitis, χ2=11.7, p<0.001
Gallstone and Alcoholic pancreatitis, χ2=25.0, p<0.001

Page 7
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
30
Table 2 Frequency (%) of TNFa, b and c microsatellite alleles in control and patient groups
TNFabc
microsatellite
alleles
Normal
controls
(n=107)
AP
Patients
(n=135)
Mild
AP*
(n=97)
Severe
AP*
(n=38)
OFS3
(n=18)
Alcoholic
AP
(n=21)
Idiopathic
AP
(n=37)
Gallstone
AP
(n=77)
TNFa
a1
0.5
0.7
0.5
1.3
0.0
2.4
1.4
0.0
a2
35.5
27.4
25.8
31.6
36.1
14.3
1
27.0
31.8
a3
0.9
0.0
0.0
0.0
0.0
0.0
0.0
0.0
a4
8.4
9.3
9.3
9.2
8.3
0.0
12.2
10.4
a5
1.9
4.8
4.6
5.3
5.6
2.4
4.1
5.8
a6
15.4
18.1
18.6
17.1
16.7
28.6
16.2
16.2
a7
7.5
7.4
7.7
6.6
11.1
9.5
10.8
4.5
a8
1.4
2.6
2.1
3.9
0.0
4.8
1.4
2.6
a9
0.9
0.7
1.0
0.0
0.0
2.4
1.4
0.0
a10
9.3
9.6
8.2
13.2
16.7
7.1
9.5
10.4
a11
16.8
18.1
20.6
11.8
5.6
26.2
14.9
17.5
a12
0.0
0.7
1.0
0.0
0.0
2.4
0.0
0.6
a13
0.9
0.0
0.0
0.0
0.0
0.0
0.0
0.0
a14
0.5
0.4
0.5
0.0
0.0
0.0
1.4
0.0
TNFb
b1
14.0
14.4
13.9
15.8
19.4
4.8
20.3
13.6
b2
0.0
0.4
0.5
0.0
0.0
0.0
0.0
0.0
b3
18.2
12.2
12.4
11.8
13.9
16.7
12.2
13.0
b4
35.5
36.3
37.6
32.9
33.3
38.1
36.5
33.8
b5
30.4
32.6
32.0
34.2
33.3
38.1
29.7
33.8
b6
0.0
0.7
1.0
0.0
0.0
2.4
0.0
0.6
b7
1.9
3.3
2.6
5.3
0.0
0.0
1.4
5.2
TNFc
c1
73.4
73.0
75.3
67.1
66.7
88.1
68.9
70.8
c2
26.6
27.0
24.7
32.9
33.3
11.9
31.1
29.2
Patient groups are described in Material and Methods
AP: Acute pancreatitis
OFS: Organ failure score (calculated according to method previously described[27])
n represents the number of subjects in each group
* Mild and severe disease severity groups are according to the Atlanta convention classification [26]
There was a trend towards reduced frequency of the TNFa2 allele in patients with alcohol induced acute
pancreatitis, but this was not significant. Controls vs. Alcoholic pancreatitis group, χ2=7.24, p=0.098; Alcoholic
pancreatitis vs. Non-alcoholic pancreatitis groups, χ2=4.51, p=0.374. The decrease in the a2 allele was not
accounted for by an increase in any one allele, both a6 and a11 were increased in frequency in the alcoholic
pancreatitis group, but not significantly so.
TNF Microsatellite 3 Locus Haplotype
Haplotypes, alleles combining in non-random
association across the TNF 3 locus
microsatellite
system,
have
been
characterised by maximum likelihood
estimates in previous population based and
family studies [16, 28, 29] and their
existence has been confirmed in homozygous
cell lines [30]. TNF haplotype analysis was
performed using all 11 haplotypes described
in European populations [29, 31]. There

Page 8
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
31
were no significant differences in haplotype
frequencies between those groups with mild
acute pancreatitis, severe acute pancreatitis,
or organ failure, or between any of the
patient groups and the normal healthy
controls (data not shown).
When patients were stratified according to
disease aetiology, the haplotype TNFa2b1c2
showed a trend toward reduced frequency in
the group with alcohol induced acute
pancreatitis. TNFa2b1c2 was present in
4.8% of individuals compared with 24.3% of
the controls (χ2=4.03, p=0.495), 31.9% of
patients with non-alcoholic pancreatitis
(χ2=6.76, p=0.108). As can be seen, none
was significant after correction for multiple
comparisons.
There was no difference in any other
haplotype frequency between the groups.
-308 Polymorphism
Allelic frequencies of this bi-allelic
polymorphism were measured in 97% of
patients. There was no difference in allelic
frequency between the normal controls and
patients or between the different patient
groups. TNF -308.G had a frequency of
78.3% in normal controls compared to
84.4% in all acute pancreatitis patients,
whilst the frequency of TNF-308.A was
21.7% in controls and 15.6% in patients
(χ2=2.78, p=0.1).
IL-10 G Microsatelite
Allelic frequencies were measured in 100%
of patients and are shown in Table 3. We
observed 11 of 15 alleles of the IL-10.G
microsatellite.
There were no differences in allele
frequencies between patients and controls, or
between controls and patient groups
stratified according to disease severity (mild
vs. severe, mild vs. OFS3).
When patients were stratified according to
aetiology of acute pancreatitis, although
there was a reduction in the frequency of the
IL-10.G13 allele in patients with alcoholic
pancreatitis compared to normal controls
(4.8% vs 21.3%, χ2=6.46, p=0.121), or
compared to those with non-alcoholic
pancreatitis (4.8% vs. 22.2%, χ2=6.97,
p=0.088); none of these was significant after
correction for multiple comparisons.
IL-10 Bi-Allelic Polymorphisms
In both controls and patient groups observed
gene frequencies did not differ significantly
from expected so Hardy-Weinberg
equilibrium was established. Due to the
presence of large numbers of heterozygotes
at each of the 3 loci, haplotypes across the 3
loci were only able to be assigned in 68 of
127 controls (53.5%) and 71 of 124 patients
(57.3%). Therefore analysis involving
haplotypes was not helpful.
Allelic frequencies of the –1117, -854, and –
627 loci were measured in 92% of patients
and are displayed in Table 4. There was no
significant difference between the normal
controls and patients or between the different
patient groups.
DISCUSSION
This study characterises cytokine gene
polymorphisms in patients with acute
pancreatitis. We have shown that the TNF
and IL-10 gene polymorphisms studied are
not associated with disease severity or
susceptibility in acute pancreatitis.
The importance of both pro-inflammatory
and regulatory cytokines in the pathogenesis
of acute pancreatitis is well established.
Animal models have shown that TNF plays
an important role in the early disease
pathogenesis. Increased TNF expression has
been demonstrated in these animal models
[5-7], and TNF antagonism is known to
ameliorate local and systemic markers of
disease [5, 8, 10]. Since TNF production in
individuals has been shown to be genetically
influenced [18], we hypothesised that
polymorphism of the TNF gene locus may

Page 9
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
32
influence disease susceptibility and course in
acute pancreatitis.
This study of the 3-locus TNFabc
microsatellites in a group of subjects with
acute pancreatitis shows no association
between severity of disease and TNF
microsatellite alleles or haplotype. The lack
of an association with the -308
polymorphism is similar to the results
reported in a study in patients with severe
sepsis [31].
The regulatory cytokine, IL-10, is
undoubtedly important in the pathogenesis of
acute pancreatitis. Unlike TNF, it is anti-
inflammatory, and reduces macrophage
secretion of TNF [11]. As a consequence,
experimental data with animals suggests that
IL-10 acts to suppress the inflammatory
process associated with acute pancreatitis.
Because a locus within the IL-10 promoter
has been shown to influence IL-10
production [25], we hypothesised that IL-10
promoter region polymorphisms may
influence the development or severity of
acute pancreatitis.
At present the importance of the IL-10.G
microsatellite in regulating IL-10 production
is
under
investigation.
However,
characterisation of the IL-10 promoter
region in which the IL-10 polymorphisms
described in this study occur, show that there
are many transcription sites close to these
polymorphisms, which may be influenced by
them. For example, there are two potential
NFκB/REL sites 60 and 80bp immediately
upstream of IL10.G [22], which may be
involved in cytokine mediated modulation of
IL-10 expression, so influencing the
pathogenesis of inflammatory disorders such
as human acute pancreatitis.
We have shown that the bi-allelic
polymorphisms of the IL-10 promoter have
no association with susceptibility or severity
of acute pancreatitis. We also investigated
the
potentially
more
informative
microsatellite, IL-10.G, and again can show
no influence upon severity or susceptibility to
acute pancreatitis.
Overall, because of the failure of any
differences we noted in frequencies of TNF
and IL-10 polymorphisms between study
groups to achieve statistical significance, we
have demonstrated no association between
TNF and IL-10 gene polymorphisms severity
or susceptibility to acute pancreatitis. On the
basis of our group of patients, it appears that
the loci, or at least their markers that we
have studied, are not associated with acute
pancreatitis. However, as we noted a trend
toward reduced frequency of the TNFa2
allele in patients with alcohol induced
pancreatitis, we are expanding studies to
determine frequency of this marker in a
larger group of patients with alcohol induced
acute and chronic pancreatitis, as we believe
this is worthy of further study.

Page 10
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
33
Table 3 Frequency (%) of IL-10.G microsatellite alleles in control and patient groups
IL-10.G
microsate
llite
alleles
Normal
controls
(n=136)
AP
Patients
(n=135)
Mild
AP*
(n=97)
Severe
AP*
(n=38)
OFS3
(n=18)
Alcoholic
AP
(n=21)
Idiopathic
AP
(n=37)
Gallstone
AP
(n=77)
4
0.4
0.0
0.0
0.0
0.0
0.0
0.0
0.0
5
0.0
0.4
0.5
0.0
0.0
0.0
0.0
0.6
7
2.9
1.1
1.0
1.3
0.0
0.0
1.4
1.3
8
1.8
3.3
4.1
1.3
0.0
9.5
4.1
1.3
9
43.8
41.9
41.8
42.1
50.0
47.6
36.5
42.9
10
7.7
7.4
8.8
3.9
2.8
19.0
6.8
4.5
11
8.1
11.1
12.4
7.9
5.6
11.9
12.2
10.4
12
4.8
7.4
8.2
5.3
2.8
2.4
8.1
8.4
13
21.3
19.6
17.0
26.3
25.0
4.8 1
21.6
22.7
14
8.8
6.3
5.2
9.2
13.9
2.4
9.5
5.8
15
0.4
1.5
1.0
2.6
0.0
2.4
0.0
1.9
Patient groups are described in Material and Methods
AP: Acute pancreatitis
OFS: Organ failure score (calculated according to method previously described[27])
n represents the number of subjects in each group
* Mild and severe disease severity groups are according to the Atlanta convention classification [26]
Controls vs. Alcohol group, χ2=6.46, p=0.121; Alcohol vs. Idiopathic and Gallstone groups combined, χ2=6.97,
p=0.088
Table 4 Frequency (%) of IL-10 –1117, -854, and -627 alleles in control and patient groups
IL-10
bi-
allelic
loci
Normal
controls
(n=127)
AP
Patients
(n=124)
Mild
AP*
(n=90)
Severe
AP*
(n=34)
OFS3
(n=18)
Alcoholic
AP
(n=21)
Idiopathic
AP
(n=33)
Gallstone
AP
(n=70)
-1117
G
53.0
56.0
56.0
56.0
67.0
57.0
58.0
55.0
A
47.0
44.0
44.0
44.0
33.0
43.0
42.0
45.0
-854
C
74.0
75.0
77.0
71.0
75.0
76.0
68.0
78.0
T
26.0
25.0
23.0
29.0
25.0
24.0
32.0
22.0
-627
C
63.8
66.8
68.0
63.2
72.0
69.0
63.0
68.0
A
36.2
33.2
32.0
36.8
28.0
31.0
37.0
32.0
Patient groups are described in Material and Methods
AP: Acute pancreatitis
OFS: Organ failure score (calculated according to method previously described[27])
n represents the number of subjects in each group
* Mild and severe disease severity groups are according to the Atlanta convention classification [26]
No significant differences in allelic frequency were found between normal controls and patients or between the
patient subgroups.

Page 11
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
34
____________________________________
Received March 15th, 2000 - Accepted May
12th, 2000
Key words
Inflammatory Response;
Interleukin-10; Tumour Necrosis Factor
Abbreviations
bp: base
pair;
ERCP: endoscopic
retrograde
cholangiopancreatography; IL: interleukin;
Kb: kilobase; OFS: organ failure score(s);
MHC: major histocompatibility complex;
TMC: tumour necrosis factor
Footnotes This work was supported by a
research grant from Plymouth Hospitals
NHS Trust
Correspondence
Andrew N. Kingsnorth
Department of Surgery
Plymouth Postgraduate Medical School
Derriford Hospital
Plymouth PL6 8DH
United Kingdom
Phone/Fax: +44-1742.763017
E-mail: andrew.kingsnorth@phnt.swest.nhs.uk
____________________________________
REFERENCES
1.
Kingsnorth AN. Role of cytokines
and their inhibitors in acute pancreatitis. Gut
1997; 40:1-4.
2.
Kusske AM, Rongione AJ, Reber
HA. Cytokines and acute pancreatitis.
Gastroenterology 1996; 110:639-42.
3.
Van der Poll T, Van Deventer SJH,
Hack CE, Wolbink GJ, Aarden LA, Buller
HR, ten Cate JW. Effects on leukocytes
following injection of tumor necrosis factor
into healthy humans. Blood 1992; 79:693-8.
4.
Van Deventer SJH, Hart M, Van der
Poll T, Hack CE, Aarden LA. Endotoxin and
tumor
necrosis
factor-alpha-induced
interleukin-8 release in humans. J Infect Dis
1993; 167:461-4.
5.
Gukovskaya AS, Gukovsky I,
Zaninovic V, Song M, Sandoval D,
Gukovsky S, Pandol SJ. Pancreatic acinar
cells produce, release, and respond to tumor
necrosis factor-a. J Clin Invest 1997;
100:1853-62. [AN: 97460013]
6.
Norman JG, Fink GW, Franz MG.
Acute pancreatitis induces intrapancreatic
tumor necrosis factor gene expression. Arch
Surg 1995; 130:966-70.
7.
Fu K, Sarras MP Jr, De Lisle RC,
Andrews GK. Expression of oxidative stress-
responsive genes and cytokine genes during
cerulein-induced acute pancreatitis. Am J
Physiol 1997; 273:G696-705.
8.
Hughes CB, Gaber LW, Mohey el-
Din AB, Grewal HP, Kotb M, Mann L,
Gaber AO. Inhibition of TNF-a improves
survival in an experimental model of acute
pancreatitis. Am Surg 1996; 62:8-13.
9.
De Beaux AC, Goldie AS, Ross JA,
Carter DC, Fearon KHC. Serum
concentrations of inflammatory mediators
related to organ failure in patients with acute
pancreatitis. Br J Surg 1996; 83:349-53.
10.
Norman JG, Fink GW, Messina J,
Carter G, Franz MG. Timing of tumor
necrosis factor antagonism is critical in
determining outcome in murine lethal acute
pancreatitis. Surgery 1996; 120:515-21.
11.
Fiorentino DF, Zlotnik A, Mosmann
TR, Howard M, O'Garra A. IL-10 inhibits
cytokine production by activated
macrophages. J Immunol 1991; 147:3815-
22.
12.
Van Laethem J, Marchant A,
Delvaux A. Interleukin-10 prevents necrosis
in murine experimental acute pancreatitis.
Gastroenterology 1995; 108:1917-22.
13.
Rongione AJ, Kusske AM, Kwan K,
Ashley SW, Reber HA, McFadden DW.
Interleukin-10 reduces the severity of acute
pancreatitis in rats. Gastroenterology 1997;
112:960-7. [AN: 97193674]
14.
Kusske AM, Rongione AJ, Ashley

Page 12
JOP - Journal of the Pancreas 2000; 1(2):24-35.
JOP – Journal Of the Pancreas www.joplink.netVol.1, No. 2 July 2000
35
SW. Interleukin-10 prevents death in lethal
necrotizing pancreatitis in mice. Surgery
1996;120:284-9.
15.
Pezzilli R, Billi P, Miniero R, Barakat
B. Serum Interleukin-10 in human acute
pancreatitis. Dig Dis Sci 1997; 42:1469-72.
16.
Jongeneel CV, Briant L, Udalova IA,
Sevin A, Nedaspasov SA, Cambon-Thomsen
A. Extensive genetic polymorphism in the
human tumour necrosis factor region and
relation to extended HLA haplotypes. Proc
Natl Acad Sci 1991; 88:9717-21. [AN:
92052163]
17.
Wilson AG, de Vries N, Poicot F, di
Giovine FS, van der Putte LBA, Duff GW.
An allelic polymorphism within the human
tumour necrosis factor a promoter region is
strongly associated with HLA A1, B8, and
DR3 alleles. J Exp Med 1993; 177:557-60.
18.
Poicot F, Briant L, Jongeneel CV.
Association of tumour necrosis factor (TNF)
and class II major histocompatibility complex
alleles with the secretion of TNF-a and TNF-
b by human mononuclear cells: a possible
link to insulin-dependent diabetes mellitus.
Eur J Immunol 1993; 23:224-31.
19.
Weissensteiner T, Lanchbury JS.
TNFB polymorphisms characterize three
lineages of TNF region microsatellite
haplotypes. Immunogenetics 1997; 47:6-16.
20.
Plevy SE, Targan SR, Yang H,
Fernandez D, Rotter JI, Toyoda H. Tumor
necrosis factor microsatellites define a
Crohn's disease-associated haplotype on
chromosome 6. Gastroenterology 1996;
110:1053-60. [AN: 96183141]
21.
Kim JM, Brannan CI, Copeland NG,
Jenkins NA, Khan TA, Moore KW.
Structure of the mouse IL-10 gene and
chromosomal localisation of the mouse and
human genes. J Immunol 1992; 146:3618-23.
22.
Eskdale J, Kube D, Tesch H,
Gallagher G. Mapping of the human IL10
gene and further characterisation of the 5'
flanking sequence. Immunogenetics 1997;
46:120-8. [AN: 97306281]
23.
Kube D, Platzer C, Von Knethen A,
Straub H, Bohlen H, Hafner M, Tesch H.
Isolation of the human interleukin 10
promoter. Characterisation of the promoter
activity in Burkitt's Lymphoma cell lines.
Cytokine 1995; 7:1-7.
24.
Eskdale J, Gallagher G. A
polymorphic dinucleotide repeat in the
human IL-10 promoter. Immunogenetics
1995; 42:444-5.
25.
Turner DM, Williams DM, Sankaran
D, Lazarus M, Sinnott PJ, Hutchinson IV.
An investigation of polymorphism in the
Interleukin-10 gene promoter. Eur J
Immunogenet 1997; 24:1-8.
26.
Bradley EL. A clinically based
classification system for acute pancreatitis.
Arch Surg 1993; 128:586-90.
27.
Kingsnorth AN, Galloway SW,
Formela LJ. Randomised, double-blind phase
II trial of Lexipafant, a platelet activating
factor antagonist, in human acute
pancreatitis. Br J Surg 1995; 82:1414-20.
28.
Nedaspasov SA, Udalova IA,
Kuprash DV, Turetskaya RL. DNA
sequence polymorphism at the human tumor
necrosis factor (TNF) locus. J Immunol
1991; 147:1053-9.
29. Crouau-Roy B, Briant L, Bouissou C,
Stavropoulos C, Poicot F, Cambon-Thomsen
A, Clayton J. Tumor necrosis factor
microsatellites in four European populations.
Hum Immunol 1993; 38:213-6.
30.
Udalova IA, Nedaspasov SA, Webb
GC, Chaplin DD, Turetskaya RL. Highly
informative typing of the human TNF locus
using six adjacent polymorphic markers.
Genomics 1993; 16:180-6.
31.
Stuber F, Udalova IA, Book M. -308
tumor necrosis factor (TNF) polymorphism
is not associated with survival in severe
sepsis and is unrelated to lipopolysaccharide
inducibility of the human TNF promoter. J
Inflamm 1996; 46:42-50

There are no products listed under this category.