null

Human VN1R5 cDNA Clone BC126341 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL801813HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VN1R5
Gene ID:
317705
Accession #:
BC126341
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human VN1R5 cDNA Clone BC126341 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VN1R5

Gene ID: 317705

Accession Number: BC126341

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTGAAATTGGTTATTATTGAGAACATGGCAGAAATTATGCTATTCTCATTAGATCTCTTGCTTTTCTCCACAGATATCCTTTGCTTTAATTTTCCTTCTAAGATGATCAAACTTCCTGGTTTTATTACCATACAAATCTTCTTTTATCCACAAGCCAGCTTTGGAATTTCAGCAAACACCATCCTTCTTCTTTTCCACATCTTCACCTTTGTTTTCAGTCACAGGTCTAAGTCCATTGACATGATAATTAGTCACCTGTCTCTCATCCACATACTGCTGCTCTTCACTCAGGCAATATTGGTGTCCTTAGACTTCTTTGGTTCACAGAATACTCAGGATGATCTTAGGTATAAGGTCATTGTCTTTTTAAACAAGGTGATGAGGGGCCTCTCCATCTGCACCCCCTGCCTCCTGAGTGTGCTCCAGGCCATCATCAGCCCCAGCATCTTCTCCTTGGCAAAGCTCAAACATCCTTCTGCAAGTCACATCTTAGGATTCTTCCTTTTCTCATGGGTCCTCAACATGTTCATTGGTGTAATCTTCTGCTGTACACTGCGGCTACCCCCAGTGAAACGGGGCCAGTCTTCTGTTTGTCATACAGCACTGTTCCTTTTTGCCCATGAGCTACACCCACAGGAGACTGTTTTTCACACTAATGACTTTGAGGGATGTCACCTTTATAGGGTTCATGGTCCTCTCAAGAGGCTACATGGTGATTATTTTATACAGACAATAAGAGGCTATCTCAGTGCCTTCACACAGCCAGCCTGTCCCCGAGTCTCACCAGTGAAAAGAGCCTCCCAGGCTATCTTACTGCTGGTGAGTTTTGTCTTCACATACTGGGTGGACTTTACGTTCTCATTTTCAGGAGGTGTGACATGGATAAATGATTCTCTGCTAGTGTGGCTCCAGGTTATTGTGGCCAATAGCTATGCCGCAATTAGTCCTTTGATGCTAATTTATGCTGATAACCAAATATTCAAGACTCTGCAAATGTTATGGTTTAAATATTTGTCTCCTCCAAAGCTCATGTTGAAATTTAATCGCCAATGTGGCAGTACTAAGAAGTGA

Length: 1074

View AllClose

0 Reviews

View AllClose