null

Human VCAM1 cDNA Clone BC068490 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL025809HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VCAM1
Gene ID:
7412
Accession #:
BC068490
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human VCAM1 cDNA Clone BC068490 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VCAM1

Gene ID: 7412

Accession Number: BC068490

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCTGGGAAGATGGTCGTGATCCTTGGAGCCTCAAATATACTTTGGATAATGTTTGCAGCTTCTCAAGCTTTTAAAATCGAGACCACCCCAGAATCTAGATATCTTGCTCAGATTGGTGACTCCGTCTCATTGACTTGCAGCACCACAGGCTGTGAGTCCCCATTTTTCTCTTGGAGAACCCAGATAGATAGTCCACTGAATGGGAAGGTGACGAATGAGGGGACCACATCTACGCTGACAATGAATCCTGTTAGTTTTGGGAACGAACACTCTTACCTGTGCACAGCAACTTGTGAATCTAGGAAATTGGAAAAAGGAATCCAGGTGGAGATCTACTCTTTTCCTAAGGATCCAGAGATTCATTTGAGTGGCCCTCTGGAGGCTGGGAAGCCGATCACAGTCAAGTGTTCAGTTGCTGATGTATACCCATTTGACAGGCTGGAGATAGACTTACTGAAAGGAGATCATCTCATGAAGAGTCAGGAATTTCTGGAGGATGCAGACAGGAAGTCCCTGGAAACCAAGAGTTTGGAAGTAACCTTTACTCCTGTCATTGAGGATATTGGAAAAGTTCTTGTTTGCCGAGCTAAATTACACATTGATGAAATGGATTCTGTGCCCACAGTAAGGCAGGCTGTAAAAGAATTGCAAGTCTACATATCACCCAAGAATACAGTTATTTCTGTGAATCCATCCACAAAGCTGCAAGAAGGTGGCTCTGTGACCATGACCTGTTCCAGCGAGGGTCTACCAGCTCCAGAGATTTTCTGGAGTAAGAAATTAGATAATGGGAATCTACAGCACCTTTCTGGAAATGCAACTCTCACCTTAATTGCTATGAGGATGGAAGATTCTGGAATTTATGTGTGTGAAGGAGTTAATTTGATTGGGAAAAACAGAAAAGAGGTGGAATTAATTGTTCAAGAGAAACCATTTACTGTTGAGATCTCCCCTGGACCCCGGATTGCTGCTCAGATTGGAGACTCAGTCATGTTGACATGTAGTGTCATGGGCTGTGAATCCCCATCTTTCTCCTGGAGAACCCAGATAGACAGCCCTCTGAGCGGGAAGGTGAGGAGTGAGGGGACCAATTCCACGCTGACCCTGAGCCCTGTGAGTTTTGAGAACGAACACTCTTATCTGTGCACAGTGACTTGTGGACATAAGAAACTGGAAAAGGGAATCCAGGTGGAGCTCTACTCATTCCCTAGAGATCCAGAAATCGAGATGAGTGGTGGCCTCGTGAATGGGAGCTCTGTCACTGTAAGCTGCAAGGTTCCTAGCGTGTACCCCCTTGACCGGCTGGAGATTGAATTACTTAAGGGGGAGACTATTCTGGAGAATATAGAGTTTTTGGAGGATACGGATATGAAATCTCTAGAGAACAAAAGTTTGGAAATGACCTTCATCCCTACCATTGAAGATACTGGAAAAGCTCTTGTTTGTCAGGCTAAGTTACATATTGATGACATGGAATTCGAACCCAAACAAAGGCAGAGTACGCAAACACTTTATGTCAATGTTGCCCCCAGAGATACAACCGTCTTGGTCAGCCCTTCCTCCATCCTGGAGGAAGGCAGTTCTGTGAATATGACATGCTTGAGCCAGGGCTTTCCTGCTCCGAAAATCCTGTGGAGCAGGCAGCTCCCTAACGGGGAGCTACAGCCTCTTTCTGAGAATGCAACTCTCACCTTAATTTCTACAAAAATGGAAGATTCTGGGGTTTATTTATGTGAAGGAATTAACCAGGCTGGAAGAAGCAGAAAGGAAGTGGAATTAATTATCCAAGTTACTCCAAAAGACATAAAACTTACAGCTTTTCCTTCTGAGAGTGTCAAAGAAGGAGACACTGTCATCATCTCTTGTACATGTGGAAATGTTCCAGAAACATGGATAATCCTGAAGAAAAAAGCGGAGACAGGAGACACAGTACTAAAATCTATAGATGGCGCCTATACCATCCGAAAGGCCCAGTTGAAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGTTTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTCGTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCAAGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAATCAAAAGTGTAG

Length: 2220

View AllClose

0 Reviews

View AllClose