null

Human VAMP5 cDNA Clone BC017891 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL025784HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VAMP5
Gene ID:
10791
Accession #:
BC017891
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human VAMP5 cDNA Clone BC017891 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VAMP5

Gene ID: 10791

Accession Number: BC017891

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCAGGAATAGAGTTGGAGCGGTGCCAGCAGCAGGCGAACGAGGTGACGGAAATTATGCGTAACAACTTCGGCAAGGTCCTGGAGCGTGGTGTGAAGCTGGCCGAACTGCAGCAGCGTTCAGACCAACTCCTGGATATGAGCTCAACCTTCAACAAGACTACACAGAACCTGGCCCAGAAGAAGTGCTGGGAGAACATCCGTTACCGGATCTGCGTGGGGCTGGTGGTGGTTGGTGTCCTGCTCATCATCCTGATTGTGCTGCTGGTCGTCTTTCTCCCTCAGAGCAGTGACAGCAGTAGTGCCCCACGGACCCAGGATGCAGGCATTGCCTCAGGGCCTGGGAACTGA

Length: 351

View AllClose

0 Reviews

View AllClose