null

Human UBE3B cDNA Clone BC141880 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL767194HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBE3B
Gene ID:
89910
Accession #:
BC141880
Plasmid:
pUC
€1,062.00
Frequently bought together:

Description

Human UBE3B cDNA Clone BC141880 pUC Plasmid | Cusabio

Gene Name: UBE3B

Gene ID: 89910

Accession Number: BC141880

Vector: pUC

Sequence: ATGTTCACCCTGTCTCAGACCTCGAGAGCATGGTTCATCGATAGAGCCCGTCAGGCACGAGAAGAAAGGCTTGTGCAGAAGGAACGGGAGCGGGCAGCTGTTGTGATCCAGGCCCATGTCCGGAGTTTTCTCTGTCGGAGTCGACTGCAGAGAGATATCAGGAGAGAGATTGATGACTTTTTTAAAGCAGATGACCCTGAGTCCACTAAAAGAAGTGCACTTTGTATTTTCAAGATTGCCAGGAAACTGCTGTTCCTATTCAGAATCAAAGAGGATAATGAGAGATTTGAGAAGTTGTGTCGCAGCATCCTGAGCAGCATGGATGCTGAGAATGAGCCTAAGGTGTGGTATGTGTCCCTGGCTTGTTCTAAGGACCTCACCCTCCTTTGGATTCAACAGATCAAGAACATTTTGTGGTACTGCTGTGATTTTCTCAAGCAGCTCAAGCCTGAAATCCTGCAGGACTCCCGACTCATCACCCTGTACCTCACGATGCTTGTCACCTTCACAGACACTTCAACGTGGAAAATTCTTCGGGGAAAAGGTGAAAGTCTTCGACCAGCGATGAACCACATTTGTGCAAATATAATGGGACATCTCAACCAGCATGGATTTTATTCTGTGCTGCAGATATTGTTAACCCGTGGCCTGGCAAGACCCCGTCCTTGTCTATCCAAAGGCACTTTAACAGCAGCTTTTTCTCTAGCGTTACGCCCTGTGATTGCTGCACAGTTCTCAGACAATCTGATTCGGCCGTTCCTCATCCACATCATGTCTGTGCCTGCTCTGGTGACTCATCTCAGCACAGTGACCCCTGAGCGCCTCACTGTTTTAGAATCCCATGACATGCTTCGTAAATTCATCATATTTTTAAGAGACCAAGATCGATGCCGTGATGTATGTGAAAGTTTAGAAGGATGCCATACGCTTTGTCTAATGGGCAACCTCCTACACTTGGGCTCCCTCAGCCCCAGAGTGTTAGAGGAGGAGACAGATGGGTTCGTGAGTTTGCTCACCCAGACGCTGTGCTACTGTCAGAAGTATGTGTCTCAGAAGAAGTCCAACCTGACCCACTGGCATCCTGTCCTTGGCTGGTTCTCCCAATCTGTGGATTATGGCCTTAACGAGTCAATGCACTTGATCACCAAACAGCTGCAGTTCTTGTGGGGGGTGCCTCTGATCCGGATCTTCTTCTGTGACATCCTGAGCAAGAAGCTACTGGAGAGCCAGGAGCCAGCCCACGCACAGCCAGCATCCCCTCAGAATGTGCTCCCAGTGAAGAGTCTCCTAAAGCGTGCTTTTCAAAAGTCGGCATCAGTCCGGAATATTCTCAGGCCTGTCGGGGGTAAACGGGTCGACTCTGCAGAAGTCCAGAAGGTTTGCAACATCTGTGTCCTCTACCAGACCTCGCTGACAACTCTCACACAGATTCGGCTGCAGATACTCACAGGTCTCACTTACCTTGATGACCTGCTTCCCAAACTGTGGGCATTTATCTGTGAGCTCGGGCCCCACGGAGGGTTAAAGCTCTTCTTGGAATGCCTGAACAATGACACTGAAGAGTCCAAGCAACTCTTGGCCATGCTGATGCTGTTCTGTGACTGTTCGCGGCACCTCATCACAATCCTTGATGACATTGAAGTTTATGAAGAACAGATTTCATTCAAACTGGAAGAGCTGGTCACTATCTCCTCTTTCCTGAATTCTTTTGTGTTTAAGATGATCTGGGATGGAATTGTAGAGAACGCCAAGGGTGAGACCTTGGAGCTGTTCCAGTCTGTCCACGGGTGGCTTATGGTGCTGTACGAGCGGGACTGCCGGCGGCGCTTCACCCCCGAGGACCACTGGCTGCGAAAGGATCTCAAACCTAGCGTGCTCTTCCAAGAACTCGACAGGGACAGAAAACGGGCACAGTTGATCCTGCAGTACATCCCACATGTCATCCCTCACAAAAACAGAGTTCTACTGTTTCGAACCATGGTTACCAAGGAGAAGGAGAAACTGGGGCTGGTGGAAACCAGCTCTGCCTCCCCGCATGTCACTCACATCACCATCCGCCGGTCCAGGATGCTGGAGGACGGCTACGAGCAGCTTAGGCAGCTCTCCCAGCACGCCATGAAGGGGGTCATCCGTGTGAAGTTTGTCAATGACCTCGGGGTGGACGAAGCAGGGATTGATCAAGACGGTGTTTTTAAGGAGTTCTTGGAAGAGATCATCAAGAGAGTTTTTGACCCAGCACTCAATCTGTTCAAGACAACCAGTGGGGATGAGAGGCTGTACCCCTCACCCACATCCTACATCCATGAGAATTACCTGCAGCTCTTCGAGTTTGTGGGGAAGATGCTGGGGAAGGCTGTGTATGAGGGAATTGTGGTGGACGTGCCATTTGCATCCTTCTTCCTGAGCCAACTGCTTGGGCACCACCACAGCGTCTTCTATAGCTCGGTGGATGAACTGCCTTCTCTGGACTCCGAGTTCTATAAAAACCTCACCTCCATCAAGCGCTATGATGGGGACATCACTGACCTGGGCCTGACGCTGTCTTACGACGAGGACGTCATGGGTCAGCTTGTTTGCCATGAACTGATTCCTGGAGGGAAGACCATTCCTGTTACAAATGAAAATAAAATTAGCTACATCCATCTGATGGCACATTTTCGAATGCACACTCAAATAAAAAACCAAACAGCTGCCCTCATTAGCGGATTCCGTTCCATTATCAAACCCGAGTGGATCCGAATGTTCTCAACTCCTGAACTGCAGCGTCTCATCTCTGGCGACAATGCTGAGATTGATCTGGAAGATTTAAAGAAGCACACAGTCTACTACGGTGGTTTCCATGGAAGTCACAGAGTCATCATCTGGCTCTGGGATATTCTGGCCTCCGACTTCACACCGGATGAGAGAGCTATGTTTCTGAAGTTCGTGACCAGCTGCTCCAGACCCCCGCTCCTGGGATTCGCCTACCTCAAGCCTCCATTCTCCATCCGCTGCGTGGAGGTGTCGGACGATCAGGACACCGGGGACACTCTGGGCAGCGTCCTCCGGGGCTTCTTCACCATCCGCAAGCGGGAGCCAGGCGGCCGCCTGCCCACCTCCTCCACCTGCTTCAACCTGCTCAAGCTGCCCAACTACAGCAAGAAGAGCGTCCTCCGCGAGAAGCTGCGCTACGCCATCAGCATGAACACGGGCTTTGAACTCTCCTAG

Length: 3207

View AllClose

0 Reviews

View AllClose