null

Human UBE2W cDNA Clone BC016326 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL842638HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBE2W
Gene ID:
55284
Accession #:
BC016326
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human UBE2W cDNA Clone BC016326 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: UBE2W

Gene ID: 55284

Accession Number: BC016326

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGTCAATGCAGAAACGACTACAGAAAGAACTGTTGGCTTTGCAAAATGACCCACCTCCTGGAATGACCTTAAATGAGAAGAGTGTTCAAAATTCAATTACACAGTGGATTGTAGACATGGAAGGTGCACCAGGTACCTTATATGAAGGGGAAAAATTTCAACTTCTATTTAAATTTAGTAGTCGATATCCTTTTGACTCTCCTCAGGTCATGTTTACTGGTGAAAATATTCCTGTTCATCCTCATGTTTATAGCAATGGTCATATCTGTTTATCCATTCTAACAGAAGACTGGTCCCCAGCGCTCTCAGTCCAATCAGTTTGTCTTAGCATTATTAGCATGCTTTCCAGCTGCAAGGAAAAGAGACGACCACCGGATAATTCTTTTTATGTGCGAACATGTAACAAGAATCCAAAGAAAACAAAATGGTGGTATCATGATGATACTTGTTGA

Length: 456

View AllClose

0 Reviews

View AllClose