null

Human UBE2G1 cDNA Clone BC002775 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL025453HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBE2G1
Gene ID:
7326
Accession #:
BC002775
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human UBE2G1 cDNA Clone BC002775 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: UBE2G1

Gene ID: 7326

Accession Number: BC002775

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACGGAGCTGCAGTCGGCACTGCTACTGCGAAGACAGCTGGCAGAACTCAACAAAAATCCAGTGGAAGGCTTTTCTGCAGGTTTAATAGATGACAATGATCTCTACCGATGGGAAGTCCTTATTATTGGCCCTCCAGATACACTTTATGAAGGTGGTGTTTTTAAGGCTCATCTTACTTTCCCAAAAGATTATCCCCTCCGACCTCCTAAAATGAAATTCATTACAGAAATCTGGCACCCAAATGTTGATAAAAATGGTGATGTGTGCATTTCTATTCTTCATGAGCCTGGGGAAGATAAGTATGGTTATGAAAAGCCAGAGGAACGCTGGCTCCCTATCCACACTGTGGAAACCATCATGATTAGTGTCATTTCTATGCTGGCAGACCCTAATGGAGACTCACCTGCTAATGTTGATGCTGCGAAAGAATGGAGGGAAGATAGAAATGGAGAATTTAAAAGAAAAGTTGCCCGCTGTGTAAGAAAAAGCCAAGAGACTGCTTTTGAGTGA

Length: 513

View AllClose

0 Reviews

View AllClose