null

Human TAP1 cDNA Clone BC014081 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL023120HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAP1
Gene ID:
6890
Accession #:
BC014081
Plasmid:
pUC
€730.00
Frequently bought together:

Description

Human TAP1 cDNA Clone BC014081 pUC Plasmid | Cusabio

Gene Name: TAP1

Gene ID: 6890

Accession Number: BC014081

Vector: pUC

Sequence: ATGGCTGAGCTTCTCGCCAGCGCAGGATCAGCCTGTTCCTGGGACTTTCCGAGAGCCCCGCCCTCGTTCCCTCCCCCAGCCGCCAGTAGGGGAGGACTCGGCGGTACCCGGAGCTTCAGGCCCCACCGGGGCGCGGAGAGTCCCAGGCCCGGCCGGGACCGGGACGGCGTCCGAGTGCCAATGGCTAGCTCTAGGTGTCCCGCTCCCCGCGGGTGCCGCTGCCTCCCCGGAGCTTCTCTCGCATGGCTGGGGACAGTACTGCTACTTCTCGCCGACTGGGTGCTGCTCCGGACCGCGCTGCCCCGCATATTCTCCCTGCTGGTGCCCACCGCGCTGCCACTGCTCCGGGTCTGGGCGGTGGGCCTGAGCCGCTGGGCCGTGCTCTGGCTGGGGGCCTGCGGGGTCCTCAGGGCAACGGTTGGCTCCAAGAGCGAAAACGCAGGTGCCCAGGGCTGGCTGGCTGCTTTGAAGCCATTAGCTGCGGCACTGGGCTTGGCCCTGCCGGGACTTGCCTTGTTCCGAGAGCTGATCTCATGGGGAGCCCCCGGGTCCGCGGATAGCACCAGGCTACTGCACTGGGGAAGTCACCCTACCGCCTTCGTTGTCAGTTATGCAGCGGCACTGCCCGCAGCAGCCCTGTGGCACAAACTCGGGAGCCTCTGGGTGCCCGGCGGTCAGGGCGGCTCTGGAAACCCTGTGCGTCGGCTTCTAGGCTGCCTGGGCTCGGAGACGCGCCGCCTCTCGCTGTTCCTGGTCCTGGTGGTCCTCTCCTCTCTTGGGGAGATGGCCATTCCATTCTTTACGGGCCGCCTCACTGACTGGATTCTACAAGATGGCTCAGCCGATACCTTCACTCGAAACTTAACTCTCATGTCCATTCTCACCATAGCCAGTGCAGTGCTGGAGTTCGTGGGTGACGGGATCTATAACAACACCATGGGCCACGTGCACAGCCACTTGCAGGGAGAGGTGTTTGGGGCTGTCCTGCGCCAGGAGACGGAGTTTTTCCAACAGAACCAGACAGGTAACATCATGTCTCGGGTAACAGAGGACACGTCCACCCTGAGTGATTCTCTGAGTGAGAATCTGAGCTTATTTCTGTGGTACCTGGTGCGAGGCCTATGTCTCTTGGGGATCATGCTCTGGGGATCAGTGTCCCTCACCATGGTCACCCTGATCACCCTGCCTCTGCTTTTCCTTCTGCCCAAGAAGGTGGGAAAATGGTACCAGTTGCTGGAAGTGCAGGTGCGGGAATCTCTGGCAAAGTCCAGCCAGGTGGCCATTGAGGCTCTGTCGGCCATGCCTACAGTTCGAAGCTTTGCCAACGAGGAGGGCGAAGCCCAGAAGTTTAGGGAAAAGCTGCAAGAAATAAAGACACTCAACCAGAAGGAGGCTGTGGCCTATGCAGTCAACTCCTGGACCACTAGTATTTCAGGTATGCTGCTGAAAGTGGGAATCCTCTACATTGGTGGGCAGCTGGTGACCAGTGGGGCTGTAAGCAGTGGGAACCTTGTCACATTTGTTCTCTACCAGATGCAGTTCACCCAGGCTGTGGAGGTACTGCTCTCCATCTACCCCAGAGTACAGAAGGCTGTGGGCTCCTCAGAGAAAATATTTGAGTACCTGGACCGCACCCCTCGCTGCCCACCCAGTGGTCTGTTGACTCCCTTACACTTGGAGGGCCTTGTCCAGTTCCAAGATGTCTCCTTTGCCTACCCAAACCGCCCAGATGTCTTAGTGCTACAGGGGCTGACATTCACCCTACGCCCTGGCGAGGTGACGGCGCTGGTGGGACCCAATGGGTCTGGGAAGAGCACAGTGGCTGCCCTGCTGCAGAATCTGTACCAGCCCACCGGGGGACAGCTGCTGTTGGATGGGAAGCCCCTTCCCCAATATGAGCACCGCTACCTGCACAGGCAGGTGGCTGCAGTGGGACAAGAGCCACAGGTATTTGGAAGAAGTCTTCAAGAAAATATTGCCTATGGCCTGACCCAGAAGCCAACTATGGAGGAAATCACAGCTGCTGCAGTAAAGTCTGGGGCCCATAGTTTCATCTCTGGACTCCCTCAGGGCTATGACACAGAGGTAGACGAGGCTGGGAGCCAGCTGTCAGGGGGTCAGCGACAGGCAGTGGCGTTGGCCCGAGCATTGATCCGGAAACCGTGTGTACTTATCCTGGATGATGCCACCAGTGCCCTGGATGCAAACAGCCAGTTACAGGTGGAGCAGCTCCTGTACGAAAGCCCTGAGCGGTACTCCCGCTCAGTGCTTCTCATCACCCAGCACCTCAGCCTGGTGGAGCAGGCTGACCACATCCTCTTTCTGGAAGGAGGCGCTATCCGGGAGGGGGGAACCCACCAGCAGCTCATGGAGAAAAAGGGGTGCTACTGGGCCATGGTGCAGGCTCCTGCAGATGCTCCAGAATGA

Length: 2427

View AllClose

0 Reviews

View AllClose