null

Human TAGLN2 cDNA Clone BC009357 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL023106HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAGLN2
Gene ID:
8407
Accession #:
BC009357
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human TAGLN2 cDNA Clone BC009357 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: TAGLN2

Gene ID: 8407

Accession Number: BC009357

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCAACAGGGGACCTGCATATGGCCTGAGCCGGGAGGTGCAGCAGAAGATTGAGAAACAATATGATGCAGATCTGGAGCAGATCCTGATCCAGTGGATCACCACCCAGTGCCGAAAGGATGTGGGCCGGCCCCAGCCTGGACGCGAGAACTTCCAGAACTGGCTCAAGGATGGCACGGTGCTATGTGAGCTCATTAATGCACTGTACCCCGAGGGGCAGGCCCCAGTAAAGAAGATCCAGGCCTCCACCATGGCCTTCAAGCAGATGGAGCAGATCTCTCAGTTCCTGCAAGCAGCTGAGCGCTATGGCATTAACACCACTGACATCTTCCAAACTGTGGACCTCTGGGAAGGAAAGAACATGGCCTGTGTGCAGCGGACGCTGATGAATCTGGGTGGGCTGGCAGTAGCCCGAGATGATGGGCTCTTCTCTGGGGATCCCAACTGGTTCCCTAAGAAATCCAAGGAGAATCCTCGGAACTTCTCGGATAACCAGCTGCAAGAGGGCAAGAACGTGATCGGGTTACAGATGGGCACCAACCGCGGGGCGTCTCAGGCAGGCATGACTGGCTACGGGATGCCACGCCAGATCCTCTGA

Length: 600

View AllClose

0 Reviews

View AllClose