null

Human TAGAP cDNA Clone BC111731 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL818676HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAGAP
Gene ID:
117289
Accession #:
BC111731
Plasmid:
pUC
€670.00
Frequently bought together:

Description

Human TAGAP cDNA Clone BC111731 pUC Plasmid | Cusabio

Gene Name: TAGAP

Gene ID: 117289

Accession Number: BC111731

Vector: pUC

Sequence: ATGAAGCTGAGAAGCAGCCACAATGCTTCAAAAACACTAAACGCCAATAATATGGAGACACTAATCGAATGTCAATCAGAGGGTGATATCAAGGAACATCCCCTGTTGGCATCATGTGAGAGTGAAGACAGTATTTGCCAGCTCATTGAAGTTAAGAAGAGAAAGAAGGTGCTGTCCTGGCCCTTTCTCATGAGAAGGCTCTCCCCTGCATCAGATTTTTCTGGGGCTTTGGAGACAGACTTGAAAGCATCGCTATTTGATCAGCCCTTGTCAATTATCTGCGGTGACAGTGACACACTCCCCAGACCCATCCAGGACATTCTCACTATTCTATGCCTTAAAGGCCCTTCAACGGAAGGGATATTCAGGAGAGCAGCCAACGAGAAAGCCCGTAAGGAGCTGAAGGAGGAGCTCAACTCTGGGGATGCGGTGGATCTGGAGAGGCTCCCCGTGCACCTCCTCGCTGTGGTCTTTAAGGACTTCCTCAGAAGTATCCCCCGGAAGCTACTTTCAAGCGACCTCTTTGAGGAGTGGATGGGTGCTCTGGAGATGCAGGACGAGGAGGACAGAATCGAGGCCCTGAAACAGGTTGCAGATAAGCTCCCCCGGCCCAACCTCCTGCTACTCAAGCACTTGGTCTATGTGCTGCACCTCATCAGCAAGAACTCTGAGGTGAACAGGATGGACTCCAGCAATCTGGCCATCTGCATTGGACCCAACATGCTCACCCTGGAGAATGACCAGAGCCTGTCATTTGAAGCCCAGAAGGACCTGAACAACAAGGTGAAGACACTGGTGGAATTCCTCATTGATAACTGCTTTGAAATATTTGGGGAGAACATTCCAGTGCATTCCAGTATCACTTCTGATGACTCCCTGGAGCACACTGACAGTTCAGATGTGTCGACCCTGCAGAATGACTCAGCCTACGACAGCAACGACCCTGATGTGGAATCCAACAGCAGCAGTGGCATCAGCTCTCCCAGCAGGCAGCCCCAGGTGCCCATGGCCACAGCTGCTGGCTTGGATAGCGCGGGCCCACAGGATGCCCGAGAGGTCAGCCCAGAGCCCATTGTGAGCACCGTGGCCAGGCTGAAAAGCTCCCTCGCACAGCCCGATAGGAGATACTCAGAGCCCAGCATGCCATCCTCCCAGGAGTGCCTCGAGAGCCGGGTGACAAACCAAACACTAACAAAGAGTGAAGGGGACTTCCCCGTGCCCCGGGTAGGCTCTCGTTTGGAAAGTGAGGAGGCTGAAGACCCATTTCCAGAGGAGGTCTTCCCTGCAGTGCAAGGCAAAACCAAGAGGCCGGTGGACCTGAAGATCAAGAACTTGGCCCCGGGTTCGGTGCTCCCGCGGGCACTGGTTCTCAAAGCCTTCTCCAGCAGCTCGCTGGACGCGTCCTCTGACAGCTCGCCCGTGGCTTCTCCTTCCAGTCCCAAAAGAAATTTCTTCAGCAGACATCAGTCTTTCACCACAAAGACAGAGAAAGGCAAGCCCAGCCGAGAAATTAAAAAGCACTCCATGTCTTTCACCTTTGCCCCTCACAAAAAAGTGCTGACCAAAAACCTCAGCGCGGGCTCTGGGAAATCGCAAGACTTTACCAGGGACCACGTCCCGAGGGGTGTCAGAAAGGAAAGCCAGCTTGCCGGCCGAATCGTGCAGGAAAATGGGTGTGAAACCCACAACCAAACAGCCCGCGGCTTCTGCCTGAGACCCCACGCCCTCTCGGTGGATGATGTGTTCCAGGGAGCTGACTGGGAGAGGCCTGGAAGCCCACCCTCTTATGAAGAGGCCATGCAGGGCCCGGCAGCCAGACTAGTGGCCTCCGAGAGCCAGACCGTGGGGAGCATGACGGTGGGGAGCATGAGGGCGAGGATGCTGGAGGCGCACTGCCTCCTACCCCCTCTTCCACCTGCTCACCACGTAGAGGACTCAAGACACAGGGGCAGCAAAGAGCCACTCCCTGGCCACGGACTCTCTCCCCTGCCTGAGCGATGGAAACAGAGCAGAACTGTCCATGCTTCTGGGGACTCTCTGGGGCACGTGTCTGGCCCAGGGAGACCTGAGCTCCTCCCGCTGAGGACCGTCTCCGAGTCCGTGCAGAGGAATAAGCGGGACTGTCTCGTGCGACGATGTAGCCAGCCGGTCTTTGAGGCTGACCAATTCCAATATGCCAAAGAATCGTATATTTAG

Length: 2196

View AllClose

0 Reviews

View AllClose