null

Human RAB27A cDNA Clone BC132800 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL019177HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RAB27A
Gene ID:
5873
Accession #:
BC132800
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human RAB27A cDNA Clone BC132800 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: RAB27A

Gene ID: 5873

Accession Number: BC132800

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTGATGGAGATTATGATTACCTCATCAAGTTTTTAGCTTTGGGAGACTCTGGTGTAGGGAAGACCAGTGTACTTTACCAATATACAGATGGTAAATTTAACTCCAAATTTATCACAACAGTGGGCATTGATTTCAGGGAAAAAAGAGTGGTGTACAGAGCCAGTGGGCCGGATGGAGCCACTGGCAGAGGCCAGAGAATCCACCTGCAGTTATGGGACACAGCAGGGCAGGAGAGGTTTCGTAGCTTAACGACAGCGTTCTTCAGAGATGCTATGGGTTTTCTTCTACTTTTTGATCTGACAAATGAGCAAAGTTTCCTCAATGTCAGAAACTGGATAAGCCAGCTACAGATGCATGCATATTGTGAAAACCCAGATATAGTGCTGTGTGGAAACAAGAGTGATCTGGAGGACCAGAGAGTAGTGAAAGAGGAGGAAGCCATAGCACTCGCAGAGAAATATGGAATCCCCTACTTTGAAACTAGTGCTGCCAATGGGACAAACATAAGCCAAGCAATTGAGATGCTTCTGGACCTGATAATGAAGCGAATGGAACGGTGTGTGGACAAGTCCTGGATTCCTGAAGGAGTGGTGCGATCAAATGGTCATGCCTCTACGGATCAGTTAAGTGAAGAAAAGGAGAAAGGGGCATGTGGCTGTTGA

Length: 666

View AllClose

0 Reviews

View AllClose