Human OSBPL8 cDNA Clone BC111728 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL874854HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OSBPL8
Gene ID:
114882
Accession #:
BC111728
Plasmid:
pUC
€794.00
Frequently bought together:

Description

Human OSBPL8 cDNA Clone BC111728 pUC Plasmid | Cusabio

Gene Name: OSBPL8

Gene ID: 114882

Accession Number: BC111728

Vector: pUC

Sequence: ATGGAGGGAGGTTTGGCAGATGGAGAACCTGATCGAACTTCGCTTCTTGGTGATAGCAAAGATGTCCTTGGGCCATCAACTGTTGTAGCAAACAGTGACGAATCTCAGCTTCTGACACCAGGAAAGATGAGTCAGCGCCAAGGAAAAGAAGCTTATCCAACGCCAACCAAAGATTTGCATCAGCCATCTCTTAGTCCAGCAAGTCCTCATAGCCAGGGTTTTGAAAGAGGGAAGGAAGATATTTCTCAAAATAAAGATGAATCTTCACTTTCTATGTCAAAGAGCAAGTCTGAATCTAAACTTTATAATGGCTCAGAGAAGGACAGTTCAACTTCAAGCAAACTCACAAAAAAAGAATCTCTTAAGGTACAAAAGAAAAATTACCGAGAAGAAAAGAAAAGAGCCACAAAGGAGCTGCTCAGTACAATCACAGATCCTTCTGTTATTGTTATGGCTGATTGGTTAAAGATTCGTGGTACTCTAAAGAGCTGGACCAAGTTATGGTGTGTGTTGAAACCTGGGGTGCTACTGATCTATAAAACCCAAAAAAATGGTCAGTGGGTAGGAACAGTTCTTCTGAATGCCTGTGAAATCATTGAACGTCCATCAAAAAAGGATGGCTTTTGTTTCAAACTTTTCCATCCTTTGGAGCAATCTATTTGGGCAGTGAAGGGTCCAAAAGGTGAAGCGGTTGGATCCATTACTCAACCCTTACCTAGCAGTTATTTGATCATCCGAGCTACTTCAGAGTCAGATGGAAGGTGCTGGATGGATGCTTTGGAGTTGGCTTTGAAATGTTCTAGTCTTCTTAAACGTACAATGATCAGAGAAGGAAAGGAACATGACCTGAGCGTTTCATCAGATAGCACACATGTGACTTTCTATGGCTTACTACGTGCTAACAATCTCCACAGTGGTGATAACTTCCAGTTAAATGATAGTGAAATTGAACGACAACATTTTAAGGACCAAGATATGTATTCTGATAAATCTGATAAAGAAAATGATCAAGAACATGATGAGTCTGATAATGAGGTGATGGGGAAAAGTGAAGAAAGTGACACAGATACATCAGAAAGACAAGATGACTCATATATCGAACCTGAGCCTGTTGAGCCTTTAAAGGAGACTACCTACACTGAACAGAGCCATGAAGAACTTGGAGAGGCAGGTGAGGCTTCTCAAACAGAAACTGTATCTGAAGAAAACAAAAGCCTTATCTGGACACTATTGAAACAAGTCCGTCCTGGCATGGACCTATCCAAGGTGGTTCTGCCTACATTTATTTTGGAACCCCGTTCTTTCCTGGATAAACTTTCAGATTACTACTATCATGCAGATTTCCTATCTGAGGCAGCTCTTGAAGAAAATCCTTATTTCCGTTTGAAGAAAGTAGTGAAATGGTATTTGTCAGGATTCTATAAAAAGCCAAAGGGACTGAAGAAACCTTATAATCCTATACTTGGCGAGACTTTCCGTTGTTTATGGATTCATCCCAGAACAAACAGCAAAACTTTTTATATTGCTGAACAGGTGTCCCATCATCCACCAATATCTGCCTTTTATGTTAGTAATCGAAAAGATGGATTTTGCCTTAGCGGTAGTATCCTGGCTAAGTCTAAGTTTTATGGAAACTCATTATCTGCAATATTAGAGGGAGAAGCACGGTTAACTTTCTTGAATAGAGGTGAAGATTATGTAATGACAATGCCATACGCTCATTGTAAAGGAATTCTTTATGGTACAATGACACTGGAGCTTGGTGGAACAGTCAATATTACATGTCAAAAAACTGGATACAGTGCAATACTTGAATTTAAACTAAAGCCATTCCTAGGGAGTAGTGACTGTGTTAATCAAATATCAGGGAAACTTAAACTGGGAAAAGAAGTCCTAGCTACTTTGGAAGGTCATTGGGATAGTGAAGTTTTTATTACTGATAAAAAGACTGATAATTCAGAGGTTTTCTGGAATCCAACACCTGACATTAAGCAATGGAGATTAATAAGGCACACTGTAAAATTTGAAGAACAGGGAGATTTTGAATCAGAGAAACTCTGGCAACGGGTAACTCGAGCCATAAATGCCAAAGACCAAACTGAAGCTACCCAAGAGAAGTATGTTTTGGAAGAAGCTCAAAGACAAGCTGCCAGGGATCGGAAAACAAAAAATGAAGAGTGGTCTTGCAAATTATTTGAACTTGATCCACTCACAGGAGAATGGCATTACAAGTTTGCAGATACCCGACCATGGGACCCACTTAATGATATGATACAGTTTGAAAAAGATGGTGTTATTCAGACCAAAGTGAAACATCGTACTCCAATGGTTAGCGTCCCCAAAATGAAACATAAGCCAACCAGGCAACAGAAGAAAGTAGCAAAAGGCTATTCCTCCCCAGAACCTGACATTCAAGACTCCTCTGGAAGTGAAGCTCAATCAGTAAAACCAAGTACAAGAAGAAAGAAAGGAATAGAACTGGGAGACATTCAGAGTTCCATCGAATCTATAAAACAAACACAGGAAGAAATTAAAAGAAATATTATGGCTCTTCGAAATCATTTAGTTTCAAGCACACCGGCCACGGATTATTTTCTGCAACAAAAAGACTACTTCATCATTTTCCTCCTGATTTTGCTTCAAGTCATAATAAACTTCATGTTCAAGTAG

Length: 2670

View AllClose

0 Reviews

View AllClose