Human ORMDL3 cDNA Clone BC017087 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL854016HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ORMDL3
Gene ID:
94103
Accession #:
BC017087
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ORMDL3 cDNA Clone BC017087 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ORMDL3

Gene ID: 94103

Accession Number: BC017087

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAATGTGGGCACAGCGCACAGCGAGGTGAACCCCAACACGCGGGTGATGAACAGCCGTGGCATCTGGCTCTCCTACGTGCTGGCCATCGGTCTCCTCCACATCGTGCTGCTGAGCATCCCGTTTGTGAGTGTCCCTGTCGTCTGGACCCTCACCAACCTCATTCACAACATGGGCATGTATATCTTCCTGCACACGGTGAAGGGGACACCCTTTGAGACCCCGGACCAGGGCAAGGCGAGGCTGCTAACCCACTGGGAGCAGATGGATTATGGGGTCCAGTTCACGGCCTCTCGGAAGTTCTTGACCATCACACCCATCGTGCTGTACTTCCTCACCAGCTTCTACACTAAGTACGACCAGATCCATTTTGTGCTCAACACCGTGTCCCTGATGAGCGTGCTTATCCCCAAGCTGCCCCAGCTCCACGGAGTCCGGATTTTTGGAATCAATAAGTACTGA

Length: 462

View AllClose

0 Reviews

View AllClose