Human ORAI3 cDNA Clone BC006126 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL887111HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ORAI3
Gene ID:
93129
Accession #:
BC006126
Plasmid:
pUC
€331.00
Frequently bought together:

Description

Human ORAI3 cDNA Clone BC006126 pUC Plasmid | Cusabio

Gene Name: ORAI3

Gene ID: 93129

Accession Number: BC006126

Vector: pUC

Sequence: ATGAAGGGCGGCGAGGGGGACGCGGGCGAGCAGGCCCCGCTGAACCCTGAGGGCGAGAGCCCTGCAGGCTCGGCCACGTACCGGGAGTTCGTGCACCGCGGCTACCTGGACCTCATGGGGGCCAGTCAGCACTCGCTGCGGGCGCTCAGCTGGCGCCGCCTCTACCTCAGCCGGGCCAAGCTCAAAGCTTCCAGCCGCACGTCTGCCTTGCTCTCGGGCTTCGCCATGGTGGCCATGGTGGAGGTGCAGCTGGAGAGTGACCACGAGTACCCACCAGGCCTGCTGGTGGCCTTCAGTGCCTGCACCACCGTGCTGGTGGCTGTGCACCTCTTTGCACTCATGGTCTCCACGTGTCTGCTGCCCCACATTGAAGCTGTGAGCAACATCCACAACCTCAACTCTGTCCACCAGTCGCCACACCAGAGACTGCACCGCTACGTGGAGCTGGCCTGGGGCTTCTCCACTGCCCTGGGCACCTTTCTCTTCCTTGCTGAAGTTGTCCTGGTTGGTTGGGTCAAGTTTGTGCCCATTGGGGCTCCCTTGGACACACCGACCCCCATGGTGCCCACATCCCGGGTGCCCGGGACTCTGGCACCAGTGGCTACCTCCCTTAGTCCAGCTTCCAATCTCCCACGGTCCTCTGCGTCTGCAGCACCGTCCCAGGCTGAGCCAGCCTGCCCACCCCGGCAAGCCTGTGGTGGTGGTGGGGCCCATGGGCCAGGCTGGCAAGCAGCCATGGCCTCCACAGCCATCATGGTACCCGTGGGGCTCGTGTTTGTGGCCTTTGCCCTGCATTTCTACCGCTCCTTGGTGGCACACAAGACAGACCGCTACAAGCAGGAACTAGAGGAACTGAATCGCCTGCAGGGGGAGCTGCAGGCTGTGTGA

Length: 888

View AllClose

0 Reviews

View AllClose