Human OR5P2 cDNA Clone BC113557 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL851980HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR5P2
Gene ID:
120065
Accession #:
BC113557
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR5P2 cDNA Clone BC113557 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR5P2

Gene ID: 120065

Accession Number: BC113557

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAATTCCCTGAAGGACGGGAATCACACCGCTCTGACGGGGTTCATCCTATTGGGCTTAACAGATGATCCAATCCTTCGAGTCATCCTCTTCATGATCATCCTATCTGGTAATCTCAGCATAATTATTCTTATCAGAATTTCTTCTCAGCTCCATCATCCTATGTATTTCTTTCTGAGCCACTTGGCTTTTGCTGACATGGCCTATTCATCTTCTGTCACACCCAACATGCTTGTAAACTTCCTGGTGGAGAGAAATACAGTCTCCTACCTTGGATGTGCCATCCAGCTTGGTTCAGCGGCTTTCTTTGCAACAGTCGAATGCGTCCTTCTGGCTGCCATGGCCTATGACCGCTTTGTGGCAATTTGCAGTCCACTGCTTTATTCAACCAAAATGTCCACACAAGTCAGTGTCCAGCTACTCTTAGTAGTTTACATAGCTGGTTTTCTCATTGCTGTCTCCTATACTACTTCCTTCTATTTTTTACTCTTCTGTGGACCAAATCAAGTCAATCATTTTTTCTGTGATTTCGCTCCCTTACTTGAACTCTCCTGTTCTGATATCAGTGTCTCCACAGTTGTTCTCTCATTTTCTTCTGGATCCATCATTGTGGTCACTGTGTGTGTCATAGCCGTCTGCTACATCTATATCCTCATCACCATCCTGAAGATGCGCTCCACTGAGGGGCACCACAAGGCCTTCTCCACCTGCACTTCCCACCTCACTGTGGTTACCCTGTTCTATGGGACCATTACCTTCATTTATGTGATGCCCAATTTTAGCTACTCAACTGACCAGAACAAGGTGGTGTCTGTGTTGTACACAGTGGTGATTCCCATGTTGAACCCCCTGATCTACAGCCTCAGGAACAAGGAGATTAAGGGGGCTCTGAAGAGAGAGCTTGTTAGAAAAATACTTTCTCATGATGCTTGTTATTTTAGTAGAACTTCAAATAATGATATTACATAG

Length: 969

View AllClose

0 Reviews

View AllClose