Human OR5L1 cDNA Clone BC109249 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL839894HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR5L1
Gene ID:
219437
Accession #:
BC109249
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR5L1 cDNA Clone BC109249 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR5L1

Gene ID: 219437

Accession Number: BC109249

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGCAAGGAAAACTGCACCACTGTGGCTGAGTTCATTCTCCTTGGACTATCAGATGTCCCTGAGTTGAGAGTCTGCCTCTTCCTGCTGTTCCTTCTCATCTATGGAGTCACGTTGTTAGCCAACCTGGGCATGATTGCACTGATTCAGGTCAGCTCTCGGCTCCACACCCCCATGTACTTTTTCCTCAGCCACTTGTCCTCTGTAGATTTCTGCTACTCCTCAATAATTGTGCCAAAAATGTTGGCTAATATCTTTAACAAGGACAAAGCCATCTCCTTCCTAGGGTGCATGGTGCAATTCTACTTGTTTTGCACTTGTGTGGTCACTGAGGTCTTCCTGCTGGCCGTGATGGCCTATGACCGCTTTGTGGCCATCTGTAACCCTTTGCTATACACAGTCACCATGTCTTGGAAGGTGCGTGTGGAGCTGGCTTCTTGCTGCTACTTCTGTGGGACGGTGTGTTCTCTGATTCATTTGTGCTTAGCTCTTAGGATCCCCTTCTATAGATCTAATGTGATTAACCACTTTTTCTGTGATCTACCTCCTGTCTTAAGTCTTGCTTGCTCTGATATCACTGTGAATGAGACACTGCTGTTCCTGGTGGCCACTTTGAATGAGAGTGTTACCATCATGATCATCCTCACCTCCTACCTGCTAATTCTCACCACCATCCTGAAGATGGGCTCTGCAGAGGGCAGGCACAAAGCCTTCTCCACCTGTGCTTCCCACCTCACAGCTATCACTGTCTTCCATGGAACAGTCCTTTCCATTTATTGCAGGCCCAGTTCAGGCAATAGTGGAGATGCTGACAAAGTGGCCACCGTGTTCTACACAGTCGTGATTCCTATGCTGAACTCTGTGATCTACAGCCTGAGAAATAAAGATGTGAAAGAAGCTCTCAGAAAAGTGATGGGCTCCAAAATTCACTCCTAG

Length: 936

View AllClose

0 Reviews

View AllClose