Human OR2K2 cDNA Clone BC111086 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL844071HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR2K2
Gene ID:
26248
Accession #:
BC111086
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR2K2 cDNA Clone BC111086 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR2K2

Gene ID: 26248

Accession Number: BC111086

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCAAGGAGAAAACTTCACCATTTGGAGCATTTTTTTCTTGGAGGGATTTTCCCAGTACCCAGGGTTAGAAGTGGTTCTCTTCGTCTTCAGCCTTGTAATGTATCTGACAACGCTCTTGGGCAACAGCACTCTTATTTTGATCACTATCCTAGATTCACGCCTTAAAACCCCCATGTACTTATTCCTTGGAAATCTCTCTTTCATGGATATTTGTTACACATCTGCCTCTGTTCCTACTTTGCTGGTGAACTTGCTGTCATCCCAGAAAACCATTATCTTTTCTGGGTGTGCTGTACAGATGTATCTGTCCCTTGCCATGGGCTCCACAGAGTGTGTGCTCCTGGCCGTGATGGCATATGACCGTTATGTGGCCATTTGTAACCCGCTGAGATACTCCATCATCATGAACAGGTGCGTCTGTGCACGGATGGCTACGGTCTCCTGGGTGACGGGTTGCCTGACCGCTCTGCTGGAAACCAGTTTTGCCCTGCAGATACCCCTCTGTGGGAATCTCATCGATCACTTCACGTGTGAAATTCTGGCGGTGCTAAAGTTAGCTTGCACAAGTTCACTGCTCATGAACACCATCATGCTGGTGGTCAGCATTCTCCTCTTGCCAATTCCAATGCTCTTAGTTTGCATCTCTTACATCTTCATCCTTTCCACTATTCTGAGAATCACCTCAGCAGAGGGAAGAAACAAGGCTTTTTCTACCTGTGGTGCCCATTTGACTGTGGTGATTTTGTATTATGGGGCTGCCCTCTCTATGTACCTAAAGCCTTCTTCATCAAATGCACAAAAAATAGACAAAATCATCTCGTTGCTTTACGGAGTGCTTACCCCTATGTTGAACCCCATAATTTACAGTTTAAGAAACAAGGAAGTCAAAGATGCTATGAAGAAATTGCTGGGCAAAATAACATTGCATCAAACACACGAACATCTCTGA

Length: 951

View AllClose

0 Reviews

View AllClose