Human OR10H1 cDNA Clone BC130360 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL896512HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR10H1
Gene ID:
26539
Accession #:
BC130360
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR10H1 cDNA Clone BC130360 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR10H1

Gene ID: 26539

Accession Number: BC130360

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCAGAGAGCCAATCACTCCACAGTGACCCAATTCATCCTCGTCGGCTTCTCTGTCTTCCCCCACCTCCAGCTGATGCTCTTCCTGCTGTTCCTGCTGATGTACCTGTTCACGCTGCTGGGCAACCTGCTCATCATGGCCACCGTCTGGAGCGAGCGCAGCCTCCACACGCCCATGTACCTCTTCCTGTGCGCCCTCTCCGTCTCCGAGATCCTCTACACCGTGGCCATCATCCCGCGCATGCTGGCCGACCTGCTGTCCACCCAGCGCTCCATCGCCTTCCTGGCCTGTGCCAGTCAGATGTTCTTCTCCTTCAGCTTCGGCTTCACCCACTCCTTCCTGCTCACCGTCATGGGCTACGACCGCTACGTGGCCATCTGCCACCCCCTGCGTTACAACGTGCTCATGAGCCCGCGGGGCTGCGCCTGCCTGGTGGGCTGCTCCTGGGCTGGTGGCTTGGTCATGGGGATGGTGGTGACCTCGGCCATTTTCCACCTCGCCTTCTGTGGACACAAGGAGATCCACCATTTTGCTTGCCATGTGCCACCTCTGTTGAAGTTGGCCTGTGGAGACGATGTGCTGGTGGTGGCCAAAGGCGTGGGCTTGGTGTGTATCACGGCCCTGCTGGGCTGTTTTCTCCTCATCCTCCTCTCCTATGCCTTCATCGTGGCCGCCATCTTGAAGATCCCTTCTGCTGAAGGTCGGAACAAGGCCTTCTCCACCTGTGCCTCTCACCTCACTGTGGTGGTCGTGCACTATGGCTTTGCCTCCGTCATTTACCTGAAGCCCAAAAGTCCCCAGTCTCTGGAAGGAGACACCTTGATGGGCATCACCTACACGGTCCTCACACCCTTCCTCAGCCCCATCATCTTCAGCCTCAGGAACAAGGAGCTGAAGGTCGCCATGAAGAAGACCTTCTTCAGTAAACTCTACCCAGAAAAAAATGTAATGATGTAG

Length: 957

View AllClose

0 Reviews

View AllClose